ID: 1003044885

View in Genome Browser
Species Human (GRCh38)
Location 6:2724587-2724609
Sequence AACTGATCATAAAAGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003044885_1003044888 28 Left 1003044885 6:2724587-2724609 CCTTCAGACTTTTATGATCAGTT 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1003044888 6:2724638-2724660 CTCCAAAGTGCATTTCTTGCAGG 0: 1
1: 0
2: 1
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003044885 Original CRISPR AACTGATCATAAAAGTCTGA AGG (reversed) Intronic
902114792 1:14112533-14112555 AAGTGATCATACAAGGGTGAGGG - Intergenic
905260352 1:36713278-36713300 AACTGATCCTAAAACTCCTATGG + Intergenic
907944687 1:59124760-59124782 AACTGATCATGAAAGACTGATGG + Intergenic
909306150 1:74080387-74080409 ACCTGGTTATAAAAGTCAGATGG + Intronic
909914986 1:81305977-81305999 AAATGTTCATAAAAATCGGATGG + Intergenic
912229128 1:107771973-107771995 TACTGTTAATAAAAGGCTGATGG - Intronic
912363833 1:109116602-109116624 AACTGATCAAACAAGTTTGGGGG + Intronic
912599235 1:110911197-110911219 AACTGTTCATAATAGTCTCCAGG - Intergenic
917143410 1:171861243-171861265 AACTGATCTTAAAATTTTTATGG + Intronic
917322214 1:173795221-173795243 AGCTGATCCTAAAATTCTTATGG + Intergenic
917370033 1:174283070-174283092 AACTAATCCTAAAATTCAGATGG - Intronic
917558174 1:176114373-176114395 AACTAATCATAAAAGTAACAAGG + Intronic
919109208 1:193196473-193196495 AACTCATCCTAAAAGTCACATGG - Intronic
922580634 1:226695340-226695362 AACCAATAATAAAAGACTGAAGG + Intronic
923608082 1:235463470-235463492 AGCTGATCATAAAATTCATATGG + Intronic
924204516 1:241698129-241698151 ATATGATCATATGAGTCTGAGGG - Intronic
924917559 1:248589099-248589121 AACTGATCAACAAAGTGAGAAGG + Intergenic
924919678 1:248614941-248614963 AGCTGTTCATAGTAGTCTGAGGG - Intergenic
1063630705 10:7731218-7731240 AACTTATGATAAAAGTCAGCAGG - Intronic
1065894730 10:30153247-30153269 AAACCATCATCAAAGTCTGAAGG - Intergenic
1066599344 10:37087295-37087317 AACTTATCATAAAATTCATATGG - Intergenic
1067975569 10:51021472-51021494 AACTGATGATATAATTGTGATGG - Intronic
1070043579 10:72807157-72807179 AGCTGAGCTTAAAAGCCTGATGG + Intronic
1070916317 10:80157467-80157489 AACAGATTATAAATTTCTGAGGG - Intronic
1071020490 10:81048663-81048685 AAATGATCATTCAAGTTTGAGGG + Intergenic
1072511145 10:96126537-96126559 AACTTTTAATAAAAGTTTGATGG - Intergenic
1073269280 10:102248445-102248467 AAATGATCATGGAAGTATGATGG + Intronic
1073818516 10:107233911-107233933 AACAGATAATAAAAGGCTGGGGG + Intergenic
1077907997 11:6548568-6548590 AGCTGAAAATAAAAGTCTAAGGG - Intronic
1078632944 11:13020243-13020265 AACTCATCCTAAAAGTCATATGG - Intergenic
1079829901 11:25250832-25250854 AAGTGAACATAAAATTCTCAGGG + Intergenic
1080546701 11:33326625-33326647 AGAAGAACATAAAAGTCTGAGGG + Intronic
1081138945 11:39474225-39474247 AAGTTATCATAAAATTTTGAAGG + Intergenic
1081367610 11:42255380-42255402 ATTTTATCATAAAAGTCTGATGG + Intergenic
1085912833 11:80848911-80848933 AATGGATCCTAAAAGGCTGATGG + Intergenic
1086992416 11:93318495-93318517 AACTGTTAATAGAAGCCTGATGG + Intergenic
1087418920 11:97896097-97896119 AACTAGTCATAAATGTCTTATGG - Intergenic
1088067871 11:105743022-105743044 CACAGAACATAAAAATCTGAGGG - Intronic
1088406578 11:109486515-109486537 AGCTCATCACAAAATTCTGATGG - Intergenic
1088562909 11:111134086-111134108 AAATGATCACCAAGGTCTGAAGG + Intergenic
1088828302 11:113514192-113514214 TACTCATCATAAATGTCTGTCGG - Intergenic
1090198955 11:124840159-124840181 AAATAATAATAAAAGGCTGAAGG - Intergenic
1091060241 11:132454346-132454368 AACTAATCTGAAAAGTGTGATGG + Intronic
1091541554 12:1467192-1467214 AACTTAACAGAAAAGTGTGATGG + Intronic
1092268124 12:6999318-6999340 AAGTGATCAAAAATGTCTGAGGG + Intronic
1092935198 12:13355449-13355471 AAATGTTCAGAAAAGTATGAAGG - Intergenic
1093299011 12:17429611-17429633 AGCTGGTGATTAAAGTCTGATGG - Intergenic
1093391372 12:18627826-18627848 AACTGATGATTAAAATATGATGG - Intronic
1093618651 12:21260087-21260109 AACTTTTCAAAAAAGTTTGAAGG - Intergenic
1093857863 12:24127568-24127590 AAGTGATCACAAAAGTGTGGCGG - Intergenic
1097104485 12:56613411-56613433 TAGGGATCATAAAAGTTTGAGGG + Intronic
1098545801 12:71710025-71710047 TATTGATCATAAAAGTCACAAGG + Intergenic
1098578666 12:72072787-72072809 AACTGAGCATAATTGTGTGATGG + Intronic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1104051197 12:125194922-125194944 AACTAATAAGAAAAGTCTGCAGG - Intronic
1104336223 12:127898436-127898458 AAATGCTCATAAATGTCTGTGGG + Intergenic
1108279713 13:48849399-48849421 AACTGATTAAAAAAATCTGCGGG - Intergenic
1109421896 13:62124008-62124030 AAATGATGATAAAATTCTGTTGG - Intergenic
1109473094 13:62836771-62836793 AATTGTTCATAAAAATTTGAAGG + Intergenic
1109983582 13:69944709-69944731 AACTGATTATAAAATTCATATGG + Intronic
1110210183 13:72962775-72962797 AACTGATCCTAAAATTCATATGG + Intronic
1111000666 13:82175636-82175658 AACTTAAAATAAAAGTTTGAAGG + Intergenic
1113864762 13:113513815-113513837 AACTGATCCTAAAATTCAGTGGG + Intronic
1115205070 14:30894030-30894052 AACTGATCAGAAAAGTTTCTCGG + Intronic
1115297689 14:31848153-31848175 TACTGATCACAAAAATTTGATGG + Intronic
1115860189 14:37677057-37677079 AACTGATCCTAAAATTCATATGG - Intronic
1116558361 14:46343152-46343174 AAATGCTCATAAAAGGATGAGGG - Intergenic
1117731725 14:58729142-58729164 AACTGATTTTAAAAGTTTGGAGG + Intergenic
1120263814 14:82223909-82223931 AACTGATCCTAAAATTCATATGG + Intergenic
1121754778 14:96393151-96393173 AACTGATCATATTAGCATGAAGG - Intronic
1124970744 15:34487790-34487812 AAACGACCATAAAAGCCTGATGG - Intergenic
1126608393 15:50503858-50503880 AATTTATCATAAGAGTCAGAAGG + Exonic
1127622889 15:60751498-60751520 TACTGATCAAAATAGCCTGAGGG - Intronic
1128831327 15:70772073-70772095 AACTGATCATAAACGACCAAAGG + Intergenic
1130665450 15:85865467-85865489 AACTGCTTATAAAGGTCTTAGGG + Intergenic
1132167549 15:99610447-99610469 AACTGATCCTAAAACTCATACGG + Intronic
1134463703 16:14453032-14453054 AACTGATTTTAAAAGTCAAAAGG + Intronic
1138814010 16:60183518-60183540 AATTCAGCATAAAAGTATGAAGG - Intergenic
1145178058 17:20719167-20719189 AACTGAACATGAAAGTTTGATGG - Intergenic
1150081589 17:62244483-62244505 AACTGAACATGAAAGTTTGATGG + Intergenic
1150460573 17:65346781-65346803 AATTGATCATTAAAGTCTGGCGG + Intergenic
1150718699 17:67595767-67595789 AAATGGCCATAAAAATCTGATGG - Intronic
1150792731 17:68211891-68211913 AACTGATTAAAAAAGACTCAAGG - Intergenic
1152123215 17:78431539-78431561 AACGGAACACAAAAGTCTGATGG - Intronic
1153994400 18:10427345-10427367 ATGTCATCATAAACGTCTGAGGG - Intergenic
1155192737 18:23445478-23445500 AACTGATCCTAAAATTCATATGG + Intergenic
1155870886 18:31026611-31026633 AACTCATCAGCAAATTCTGATGG - Intronic
1156333820 18:36150890-36150912 AACAGAACATAAAAATCTAAGGG - Intronic
1157852574 18:51069975-51069997 AACTGATCATGAAATTCATATGG - Intronic
1161227960 19:3156090-3156112 ATCTGACCACAAAAGGCTGAAGG - Intronic
1161914756 19:7220064-7220086 AGCCAATCATAAGAGTCTGAAGG + Intronic
1164042186 19:21503565-21503587 AGCTGATGATACATGTCTGAAGG + Intronic
1164057832 19:21637121-21637143 AGCTGATGATACATGTCTGAAGG + Intergenic
1164307974 19:24021754-24021776 AGCTGATGATACATGTCTGAAGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
932804632 2:74772748-74772770 AACTGAACATAAAATTGTGCTGG + Intergenic
933850691 2:86364253-86364275 AACTGATGATACTTGTCTGAAGG - Intergenic
935146328 2:100398056-100398078 AACTCATCAGAAACGTCTGCAGG - Exonic
937147197 2:119657736-119657758 AAATGATGAGAAAAGACTGAGGG - Intronic
939875434 2:147572264-147572286 AACTGATGTGAAAAGTCTGTGGG - Intergenic
940594859 2:155777979-155778001 TAATGATCACAAAAATCTGAAGG + Intergenic
941609069 2:167637696-167637718 AATTGATCATATAAGGCAGAGGG - Intergenic
942402554 2:175618725-175618747 AAATGATACTAAAAGTCTTATGG - Intergenic
942405326 2:175647479-175647501 CACTGATCATAACACTCTGTTGG - Intergenic
946623386 2:221583743-221583765 AACTGTGCTTAAAAGTTTGATGG + Intergenic
947885934 2:233571248-233571270 AACTGATTCTAAAATTCTTATGG + Intergenic
1169127965 20:3144176-3144198 AACTGATCCTAAAATTCATATGG + Intronic
1169613030 20:7404773-7404795 ATCTGATCTTAAAAGTCATATGG - Intergenic
1170972577 20:21129920-21129942 AACAGATCAGAAAAGGCTAATGG - Intronic
1170985649 20:21255725-21255747 AGCTGGTCATAAAACTCAGAAGG + Intergenic
1172695328 20:36818467-36818489 AAATGGTCATAAGAGACTGATGG + Intronic
1172769245 20:37369180-37369202 AACTGATCTTAAAATTCATATGG - Intronic
1175668434 20:60880143-60880165 AACTCATCATAAAAGACAGAGGG + Intergenic
1176269703 20:64229829-64229851 AACTGGTCATAAAAGTCTTGCGG + Intronic
1178057666 21:28817670-28817692 AACTGCTAATAAATGTCTGATGG + Intergenic
1180012976 21:45063616-45063638 AGCTGATCCTAAAAGTTTAATGG + Intergenic
1183105555 22:35612615-35612637 AACTGATTTTAAAATCCTGATGG + Intronic
1185134393 22:49061018-49061040 AAGTGGTCAGAAAAGTATGAAGG - Intergenic
950641070 3:14348638-14348660 CACTGAACATAATAGCCTGAAGG - Intergenic
953234783 3:41096564-41096586 AACTGATGACAAAAGCCTGCAGG - Intergenic
953971382 3:47350630-47350652 ATCTGATCATAAAAGTGACATGG - Intergenic
956075148 3:65497102-65497124 AGCTGACCTTAAAAGTCTGAAGG + Intronic
957743037 3:84299389-84299411 AACTGATCATAAGGCTCTGGCGG - Intergenic
958551083 3:95613885-95613907 AAATGATCACAAAACTCTGCAGG + Intergenic
959030429 3:101293470-101293492 AATGGAACAAAAAAGTCTGATGG - Intronic
960486298 3:118257167-118257189 AACTAATCCTAAAATTCTTATGG + Intergenic
960545055 3:118904546-118904568 TACTAATCATAAAACTCTGATGG - Intronic
960658806 3:120035454-120035476 AACTGATCCTAAAATTCATATGG - Intronic
961295812 3:125883496-125883518 CACTGATCTTCATAGTCTGAAGG - Intergenic
962966721 3:140362158-140362180 ACTTGATCATAAAAGTTTAAGGG - Intronic
966090214 3:176125210-176125232 AGCTGATCCTAAAATTCTTATGG - Intergenic
970391873 4:15620424-15620446 AACCGACCCTAAAATTCTGATGG + Intronic
971783495 4:31069628-31069650 AAATGATGATAAAAGTTTGATGG + Intronic
972548910 4:40109113-40109135 CACTTATCATAAAAGACTGAGGG - Intronic
974035840 4:56817440-56817462 AATTGATCTTAAAATTCAGATGG + Intronic
974986269 4:69029903-69029925 AACTGATAAGAGAAGTTTGAGGG - Intronic
975360331 4:73462257-73462279 AACTGATTCTAAAAGTCATATGG + Intergenic
977268734 4:94887955-94887977 CAATGATCATAAAATTCTAAGGG + Intronic
977952434 4:102988064-102988086 AACTGATAATAAAATTTTAATGG + Intronic
978790604 4:112659925-112659947 AACTGATCAGAAAAATGTGATGG + Intergenic
979096061 4:116553038-116553060 CACTGCTCATAACACTCTGAAGG + Intergenic
981584390 4:146285497-146285519 AATTGATCCTAAGAGTCAGAAGG - Intronic
982326235 4:154131217-154131239 AGCTGATCATAAAATTCATATGG + Intergenic
982798900 4:159677712-159677734 ATCTGATAATAAAAGGCTGTGGG + Intergenic
984750999 4:183274218-183274240 AACTGATACTAAAACTCTTATGG - Intronic
985299561 4:188473465-188473487 AACTGATCTTAAAATACTGTAGG - Intergenic
985926964 5:3026440-3026462 AACTGCCCAGCAAAGTCTGATGG + Intergenic
986934596 5:12867395-12867417 AACAGAGTATAAAAGTTTGAAGG + Intergenic
987972253 5:24962483-24962505 AACTGATCCTAAAACTCACATGG - Intergenic
989765492 5:45077801-45077823 AACAGAACATAGAAGGCTGAAGG + Intergenic
990079507 5:51896276-51896298 AAGTGTTCATAAAAGTCTTCTGG - Intergenic
993687609 5:90959459-90959481 ACCTCATCATAAAAGTCATATGG + Intronic
993762778 5:91817535-91817557 AAGTGATTACAAAAGTGTGATGG + Intergenic
994946990 5:106407591-106407613 AACTGATAATAAATGCCTGTTGG + Intergenic
994983903 5:106911084-106911106 AAGTGATCAAAAAAATCAGAGGG + Intergenic
995506348 5:112864230-112864252 AACAGAACATAAACTTCTGAGGG - Intronic
998894401 5:146783539-146783561 AACTGATTATAAAAGTTGTATGG - Intronic
1001248694 5:170127115-170127137 AGCTGAGCATAACAATCTGATGG + Intergenic
1003044885 6:2724587-2724609 AACTGATCATAAAAGTCTGAAGG - Intronic
1004268444 6:14171481-14171503 AACTGATCCTAAAATTCATATGG + Intergenic
1008516834 6:52326504-52326526 AGCTAAACATAAAAGTCAGAGGG - Intergenic
1012044490 6:94252737-94252759 AACTGAATATCAAAATCTGAGGG - Intergenic
1012629070 6:101441148-101441170 AAGAGAACACAAAAGTCTGAAGG - Intronic
1014141057 6:117942938-117942960 AATTGATCATAATTGTCTCAGGG - Intronic
1016087221 6:139928715-139928737 AACTGATCATGAAATTTTGCCGG - Intergenic
1017254147 6:152314253-152314275 AAAAGATCCTAAAAGTCTGTTGG - Intronic
1019584260 7:1788358-1788380 AACTAATATTAACAGTCTGATGG - Intergenic
1020474282 7:8577562-8577584 AATTGATAATAAATGTTTGAAGG - Intronic
1020592747 7:10162413-10162435 AACTGATGAAAAATGTTTGATGG + Intergenic
1021581215 7:22155842-22155864 AACTGATAAAAAGAGTCTGGGGG + Intronic
1021983216 7:26074905-26074927 AACTGATCAGGAAAGTGTTAGGG - Intergenic
1022216281 7:28265416-28265438 TACTGGTTATAAAAGTTTGAGGG - Intergenic
1025801766 7:64793625-64793647 AGCTGATGATACATGTCTGAAGG + Intergenic
1028418993 7:90611237-90611259 AACTGATCATAGAGGACAGAAGG - Intronic
1028769734 7:94604365-94604387 AACTGATCCTAAAATTCCTAAGG + Intronic
1029040225 7:97565521-97565543 AACTAAACATAAAATCCTGAGGG + Intergenic
1029265423 7:99335564-99335586 AACTGATCCTAAAATTCATATGG - Intronic
1030691096 7:112534609-112534631 AACTGATCCTAAAATTCATAAGG - Intergenic
1030711168 7:112751081-112751103 CTCTGAACATAAAAGTCGGAAGG + Intergenic
1031037656 7:116805699-116805721 CACAGTTCAGAAAAGTCTGAAGG + Intergenic
1031864066 7:127018306-127018328 AAGTGATCACCAAAGTCAGAGGG + Intronic
1035782671 8:2240815-2240837 AGCTGATTATAAAAATGTGAAGG - Intergenic
1035809452 8:2478774-2478796 AGCTGATTATAAAAATGTGAAGG + Intergenic
1035898270 8:3429296-3429318 AAATGATAATAAAATGCTGAAGG + Intronic
1038117467 8:24573527-24573549 AACTGATCATAGACATATGAGGG + Intergenic
1038263035 8:26014342-26014364 TACTAATAATAAAAGTCAGAGGG - Intronic
1039234794 8:35489872-35489894 AACTGAACATAAATCTTTGATGG - Intronic
1039939836 8:42080564-42080586 AACTGACCCTAAAATTCTCATGG - Intergenic
1041505063 8:58587567-58587589 AACTGACCTTAAAAGTCTAGGGG - Intronic
1042392817 8:68255708-68255730 ATCTAATGAGAAAAGTCTGATGG + Intergenic
1043381403 8:79706004-79706026 ACCTGATCATCAAAGCCAGAAGG + Intergenic
1044939578 8:97327193-97327215 AACTAATCTTAAAAGTCTTTGGG + Intergenic
1044981731 8:97723093-97723115 TTCTGATCTTAAAAGTCTAATGG + Intronic
1045622989 8:104004566-104004588 AACTTATCAAGAAAGTGTGAAGG + Intronic
1046912384 8:119643256-119643278 AACTGAGCAGAAAATTTTGATGG + Intronic
1047864805 8:129011046-129011068 AACTCATCAAAAAAGTTTTAAGG - Intergenic
1054753034 9:68928295-68928317 AACTGATTATAAAATTCATAGGG - Intronic
1056954531 9:91071754-91071776 AACAGATCAGAAAAGGCAGAGGG + Intergenic
1058712935 9:107696900-107696922 AACTGTGCATAAAAGTCTGCAGG + Intergenic
1187680821 X:21766382-21766404 AACTGATCCTAAAATTCATATGG - Intergenic
1188502119 X:30838518-30838540 AACTGATTATAAAATTCATATGG - Intronic
1189087266 X:38038723-38038745 AACTGATTAGTACAGTCTGAAGG - Intronic
1190454684 X:50616208-50616230 AACTGACCATAAAGGTTTCAAGG - Intronic
1190719065 X:53132240-53132262 AACTGATCCTAAAATTCATATGG + Intergenic
1193523356 X:82557876-82557898 AACTAAACAAAAAAGTATGAAGG + Intergenic
1197495095 X:127170277-127170299 AAATGAGAATAAAAGCCTGAAGG + Intergenic
1197576292 X:128216053-128216075 ATCTGATCATAAAATTCATATGG + Intergenic
1197862771 X:130988040-130988062 AAGTGCTCATAAAAGTCACATGG + Intergenic
1198497306 X:137205251-137205273 AACTGTTCAAAAAACTTTGAGGG - Intergenic
1199577337 X:149325142-149325164 AAGGGATCATAAAACTCTAAAGG + Intergenic
1199931170 X:152523989-152524011 AACTGATCCTAAAATTCATATGG + Intergenic