ID: 1003045395

View in Genome Browser
Species Human (GRCh38)
Location 6:2728900-2728922
Sequence CCACGGTGGATGGCAGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003045390_1003045395 4 Left 1003045390 6:2728873-2728895 CCTCAGAGGAAAGAGAGCTGAGA 0: 1
1: 1
2: 5
3: 65
4: 413
Right 1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG 0: 1
1: 1
2: 1
3: 9
4: 123
1003045386_1003045395 30 Left 1003045386 6:2728847-2728869 CCCCAAGAAGCTATCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 197
Right 1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG 0: 1
1: 1
2: 1
3: 9
4: 123
1003045387_1003045395 29 Left 1003045387 6:2728848-2728870 CCCAAGAAGCTATCTCTGCTGCT 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG 0: 1
1: 1
2: 1
3: 9
4: 123
1003045388_1003045395 28 Left 1003045388 6:2728849-2728871 CCAAGAAGCTATCTCTGCTGCTG 0: 1
1: 0
2: 3
3: 21
4: 239
Right 1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG 0: 1
1: 1
2: 1
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003045395 Original CRISPR CCACGGTGGATGGCAGATCC TGG Intronic
900174963 1:1287592-1287614 CCACGGTGGGTGCCAGCCCCTGG + Exonic
901058576 1:6461041-6461063 CCACCATGGGTGCCAGATCCCGG + Intronic
901756089 1:11442429-11442451 CCAGCGTGGAAGGCAGAGCCTGG - Intergenic
903871763 1:26440628-26440650 CCACTGTGGATGGCACATCTGGG - Intronic
905043276 1:34977272-34977294 CCACGTTGGCTGGCAGCCCCAGG + Intergenic
906494805 1:46297315-46297337 TCACAATGGATGGCAGAGCCAGG - Intronic
907385239 1:54121682-54121704 CCAGGGTGGCCGGCAGCTCCCGG + Intergenic
911874542 1:103142748-103142770 CCACGCTGGATTCCAGCTCCTGG - Intergenic
912417060 1:109516483-109516505 ACACAGTGGGTGGCAGAGCCAGG - Intergenic
915078973 1:153338262-153338284 CCAGGGTGCAGGGCAGATCAGGG - Intronic
918728083 1:187951063-187951085 CTGCGGTGGTTGGCAGATACAGG + Intergenic
919293351 1:195662383-195662405 TCACGGTGGTAGGCAGTTCCTGG + Intergenic
920581162 1:207109179-207109201 CCACAGTGGAGACCAGATCCAGG + Intronic
922752652 1:228077888-228077910 CCAGGCTGGATGTCAGAACCTGG - Intergenic
924386286 1:243501023-243501045 CCACTGGGGTTGACAGATCCAGG - Exonic
1063598027 10:7454907-7454929 CCACGGTGGATTGCCTCTCCCGG + Intergenic
1070834438 10:79439071-79439093 CCACAGTGGATCACAGATCAAGG - Intronic
1073290167 10:102409415-102409437 CCAGCGTGGGTGGCAGCTCCAGG + Intronic
1074591699 10:114820257-114820279 CCACTGTGGGTGGCAGAGCTGGG + Intergenic
1075652122 10:124134368-124134390 CCACAGGGCATGGCACATCCAGG + Intergenic
1076313478 10:129524387-129524409 GCACGGTGCATGGCAGAGCTGGG - Intronic
1076505520 10:130970548-130970570 CCACAGTGGATGGCAGAGGTGGG - Intergenic
1080861361 11:36153038-36153060 CCATGGTAAATGGCAGATTCAGG - Intronic
1082005439 11:47416354-47416376 CCACGGTGAAGGGCAGGGCCAGG - Exonic
1082789729 11:57338934-57338956 CCTCGGTGGAGGGCAGTGCCGGG - Intronic
1083140596 11:60718224-60718246 CCATGGTGGGTGTGAGATCCGGG - Intergenic
1083211977 11:61193879-61193901 CCTCGGAGCAAGGCAGATCCCGG - Intergenic
1088227549 11:107638057-107638079 TCACGGTGAATGGCAGAGCATGG - Intronic
1089291485 11:117440038-117440060 CCAAGGTGGAGGTCAGATCGGGG - Intronic
1089589139 11:119529405-119529427 CCAGGGAAGATGGCAGACCCAGG - Intergenic
1091113514 11:132993469-132993491 CAACGGTGGTTAGCAAATCCAGG - Intronic
1091172415 11:133530475-133530497 CCCAGCTGGATGGCAGCTCCGGG - Intronic
1092861008 12:12718686-12718708 CCACTGGGGATGACGGATCCAGG + Intronic
1095969999 12:47894941-47894963 CCACGGAGGATGGAAACTCCTGG - Intronic
1096411083 12:51377531-51377553 TCAGGGTGGGTGGCAGATACCGG - Intronic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1102251343 12:111389620-111389642 CCACATTGGAAGGCAGGTCCAGG + Intergenic
1106433574 13:29704944-29704966 CCAGAGTGGAAGGCAAATCCAGG + Intergenic
1106954817 13:34924829-34924851 CCACTGTGGATTGCAGAGGCAGG + Intergenic
1106987471 13:35372440-35372462 GCACTGGGGAGGGCAGATCCAGG + Intronic
1108582559 13:51839433-51839455 CCATGGGGGCTGGCTGATCCAGG + Intergenic
1110324680 13:74200260-74200282 CAAGGGTGGATGGTAGATTCAGG + Intergenic
1115752497 14:36506083-36506105 CCAGGATGGAAGGCGGATCCCGG - Intronic
1116641094 14:47464210-47464232 CAAAGGTGGATGTGAGATCCAGG + Intronic
1118632499 14:67718524-67718546 CCTGGGAGGATGGCTGATCCGGG + Intronic
1120180667 14:81339409-81339431 GCAAGGTGGATGGCAGCTCAGGG + Intronic
1121327547 14:93030016-93030038 CCACAGAGGATTTCAGATCCAGG + Intronic
1121504881 14:94469503-94469525 CCCTGGTGGATGGCAGACTCTGG + Exonic
1123139436 14:106061109-106061131 CCACGGTGGATGGCAGATGCAGG + Intergenic
1123156676 14:106234020-106234042 CCATGGTGGACGGCAGATGCAGG + Intergenic
1123187678 14:106536191-106536213 CCGTGGTAGATGGCAGATGCAGG + Intergenic
1123207450 14:106727115-106727137 CCATGCTGGACGGCAGATGCAGG + Intergenic
1123212473 14:106774109-106774131 CCATGCTGGATGGCAGATGCAGG + Intergenic
1128024542 15:64424027-64424049 TAAGGGTGGAGGGCAGATCCTGG + Exonic
1131656625 15:94467310-94467332 ACACAGTGGATGGCAGATCCTGG - Intronic
1132548526 16:544642-544664 CCAAGCTGGATGGAAGATCGAGG - Intronic
1132637439 16:959000-959022 CCACTGTGGATGGCAGACGGTGG + Intronic
1135682670 16:24471762-24471784 CCACGGTGGATGACAGCTGAAGG - Intergenic
1139148123 16:64346389-64346411 CCTTGGTGGATGTCGGATCCAGG + Intergenic
1139595313 16:67954393-67954415 CCCAGGTGGATGGAACATCCAGG + Intronic
1140454839 16:75098998-75099020 CCAAGGTGGATGGAGGAACCTGG - Intronic
1141157314 16:81606336-81606358 CCAGGGTGCATGGGAGAGCCAGG + Intronic
1142605917 17:1080993-1081015 CCACCCTGGAGGGCAGAGCCAGG - Intronic
1143803903 17:9409230-9409252 CCACGGGGGAAGGCAGAAACCGG - Intronic
1144946449 17:18971854-18971876 CCCTGGTGAATGGCAGAGCCAGG - Intronic
1147055082 17:37827932-37827954 CCACAGTGAGTGGCAGAGCCAGG + Intergenic
1147497153 17:40927748-40927770 ACATGGTAGGTGGCAGATCCAGG - Intronic
1147630185 17:41925224-41925246 CCAGGGTGGAGGGCAGTTGCAGG - Intronic
1149659000 17:58324728-58324750 GCACGGTGCAGGGGAGATCCCGG + Intronic
1150418010 17:65003087-65003109 CCAGGGTGGATTGCAGAAGCAGG - Intergenic
1152927509 17:83094122-83094144 CCACGCTAGATGGCAGAGTCGGG + Intronic
1153885076 18:9457348-9457370 CCTTGGTGGATGGCACATCCTGG + Intergenic
1154021766 18:10669281-10669303 TCACGGAGGAAGGCAGGTCCAGG - Intronic
1154026162 18:10709263-10709285 CGAGGGAAGATGGCAGATCCAGG + Intronic
1156789749 18:40956413-40956435 CTGAGGTGGATGGCAGATGCAGG + Intergenic
1158200223 18:54931215-54931237 CCAAGCTAGATGGCAGAGCCTGG - Intronic
1160738130 19:674081-674103 CCACGGTGGGTGTCTGAGCCAGG + Intergenic
1160860302 19:1234801-1234823 GCAGGGTGGATGGCAGAGCACGG - Intronic
1163522180 19:17797938-17797960 CCACAGGGGCTGGCAGATCAGGG + Intronic
1164880879 19:31731839-31731861 CCTCGGGGGACGGCAGATCCTGG - Intergenic
1164947047 19:32304477-32304499 CCATGGTGGAGGGAAGATGCTGG + Intergenic
1165302163 19:34977070-34977092 CCACTGTGGACTGCAGACCCTGG - Intergenic
925624462 2:5828573-5828595 CCTCGGGGGCTGTCAGATCCAGG - Intergenic
925992190 2:9262749-9262771 CCCAGTTGGATGGCAGAGCCTGG + Intronic
926108899 2:10169789-10169811 CCAGGGGGGATGGCAGCCCCCGG + Intronic
930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG + Intergenic
935330846 2:101976609-101976631 CCACGGTCACTGGCAGATTCCGG + Intergenic
935380896 2:102449957-102449979 CCTCGGTGGATGGAAGTACCAGG - Intronic
937244838 2:120485990-120486012 CCACAGTGAATGGCACCTCCTGG - Intergenic
937447744 2:121973092-121973114 CCACAGGGGATGCCACATCCAGG - Intergenic
938133069 2:128733708-128733730 CCACTGAGGATGGCAGGGCCAGG - Intergenic
944902607 2:204231019-204231041 CCACAGTGAATGGCAGAGCCAGG + Intergenic
1173125206 20:40330184-40330206 CCATTGTGGATGGAAGAGCCTGG + Intergenic
1175121197 20:56717429-56717451 CCAAAGGGGATGGGAGATCCTGG - Intergenic
1179887463 21:44320312-44320334 CCACTGTGGCTGGCAGGTCCCGG + Intronic
1181262859 22:21611254-21611276 CCACTGTGGATGGCAGCCCAGGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
960966246 3:123106785-123106807 CCACTGTGGGAGGAAGATCCTGG + Exonic
967331435 3:188294013-188294035 CCAGGCTGGAGGGCAGATCTCGG - Intronic
968396354 4:242196-242218 CCACGTTGGGTGGCAGATGAAGG - Intergenic
968628788 4:1639583-1639605 CAACGGAGGAGGGCAGAGCCTGG + Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
975326991 4:73069657-73069679 CCACGGCGGAGCCCAGATCCCGG + Exonic
978444740 4:108769763-108769785 CCAGGCTGGGTGGCAGAGCCTGG - Intergenic
983597125 4:169482329-169482351 CCAGGCTGGAGTGCAGATCCAGG + Intronic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
998186216 5:139981849-139981871 CCAGGGAGGAGGGCAGATACTGG - Intronic
1001907645 5:175486336-175486358 CCAGGTTGCATGGCAGATGCTGG - Intronic
1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG + Intronic
1004120540 6:12817444-12817466 CCACAGTATATGGCAGAGCCCGG - Intronic
1006075775 6:31531314-31531336 CCACGGTGGATGGCAATGGCTGG + Exonic
1006092531 6:31636515-31636537 CCGAAGGGGATGGCAGATCCTGG - Exonic
1006838389 6:37013151-37013173 CCACTGTGGCTGGCCAATCCTGG + Intronic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1019665395 7:2249728-2249750 CCAGGGTGGATGGGAGACCCAGG - Intronic
1024279966 7:47710640-47710662 CCAACGCGGAGGGCAGATCCTGG + Intronic
1024603678 7:51008346-51008368 CCATGGTGGGTGGGAGGTCCCGG - Intergenic
1029292003 7:99509233-99509255 CCACTTTGGAAGGCAGAGCCAGG - Intronic
1032733373 7:134666422-134666444 CCAAGGAGGATGGCAGATAGAGG + Intronic
1032850249 7:135788871-135788893 CCACGGTGTTTGGCTGATTCTGG + Intergenic
1037806425 8:22060116-22060138 CCACAGAGGAAGGCAGGTCCAGG - Intronic
1049876687 8:145027807-145027829 CCACGTTGGGTGGCAGATGAAGG + Intergenic
1050325961 9:4497272-4497294 CCAAGGTCGAGGGCAGAGCCGGG + Intronic
1059547367 9:115191679-115191701 CAACTGTGGATAGCAGATCCAGG - Intronic
1060122712 9:121009898-121009920 TCACGGTGGAAAGCAGAACCAGG + Intronic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1061848375 9:133400682-133400704 CCAAGGTGGATGCCAGGGCCAGG + Intronic
1062396534 9:136355060-136355082 CGAGGGTGGATGACACATCCTGG + Intronic
1187055463 X:15738117-15738139 CCAGGGTGGAGGGCAGAGACTGG + Intronic
1189746834 X:44177176-44177198 CCAGGGTGGAAGGCAGGGCCAGG + Intronic
1190912652 X:54787007-54787029 TCACGGTGCATGGGAGTTCCTGG + Intronic
1191938415 X:66451200-66451222 CCATAGTGGAAGGCAGGTCCTGG - Intergenic
1196717428 X:118824591-118824613 CCACAGGGGGTCGCAGATCCGGG - Exonic
1199626998 X:149750409-149750431 CCTTGATGGCTGGCAGATCCTGG - Intergenic
1201940041 Y:19449527-19449549 CCAGGGGGTATGGCAGTTCCAGG - Intergenic