ID: 1003050242

View in Genome Browser
Species Human (GRCh38)
Location 6:2774048-2774070
Sequence TTTCTATTCAATGGCACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003050242_1003050247 7 Left 1003050242 6:2774048-2774070 CCTTTTGTGCCATTGAATAGAAA 0: 1
1: 0
2: 2
3: 35
4: 324
Right 1003050247 6:2774078-2774100 AGTGGAACTCCAGAATACAAGGG No data
1003050242_1003050251 29 Left 1003050242 6:2774048-2774070 CCTTTTGTGCCATTGAATAGAAA 0: 1
1: 0
2: 2
3: 35
4: 324
Right 1003050251 6:2774100-2774122 GATTGGCCAGAATAAATGGTTGG No data
1003050242_1003050248 12 Left 1003050242 6:2774048-2774070 CCTTTTGTGCCATTGAATAGAAA 0: 1
1: 0
2: 2
3: 35
4: 324
Right 1003050248 6:2774083-2774105 AACTCCAGAATACAAGGGATTGG 0: 1
1: 0
2: 0
3: 11
4: 198
1003050242_1003050246 6 Left 1003050242 6:2774048-2774070 CCTTTTGTGCCATTGAATAGAAA 0: 1
1: 0
2: 2
3: 35
4: 324
Right 1003050246 6:2774077-2774099 TAGTGGAACTCCAGAATACAAGG 0: 1
1: 0
2: 1
3: 6
4: 113
1003050242_1003050250 25 Left 1003050242 6:2774048-2774070 CCTTTTGTGCCATTGAATAGAAA 0: 1
1: 0
2: 2
3: 35
4: 324
Right 1003050250 6:2774096-2774118 AAGGGATTGGCCAGAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003050242 Original CRISPR TTTCTATTCAATGGCACAAA AGG (reversed) Intronic
902422630 1:16293443-16293465 TTTTTTATGAATGGCACAAACGG + Intronic
905730261 1:40294110-40294132 TTTGTATTCAAAGGCACAGAAGG - Exonic
906621982 1:47289530-47289552 TCTCTATTCTATGACACATAAGG - Exonic
909184731 1:72472070-72472092 TTTCTATTAAAAGGAACAAAAGG - Intergenic
909402507 1:75249878-75249900 TTTCTATACCATGGAACAAATGG - Intronic
911809318 1:102253667-102253689 CTTCTATGCAATGGCTCCAATGG + Intergenic
912170703 1:107095788-107095810 TTTCTGTTCAATAGCACCAAAGG - Intergenic
912255772 1:108056435-108056457 TTTCCCTTCATGGGCACAAAAGG - Intergenic
912275213 1:108250413-108250435 TTTCTATTAAATAGCGAAAAAGG - Intergenic
912293009 1:108443936-108443958 TTTCTATTAAATAGCGAAAAAGG + Intronic
912792535 1:112666334-112666356 ATCCTATTCAAATGCACAAAAGG + Intronic
913247763 1:116885296-116885318 TTTTTATCCAATGGCACAGAAGG + Intergenic
913794029 1:122581069-122581091 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913794264 1:122585148-122585170 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913794340 1:122586508-122586530 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913794488 1:122589231-122589253 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913794852 1:122595692-122595714 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913795575 1:122608274-122608296 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913796321 1:122621536-122621558 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913798866 1:122667083-122667105 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913804974 1:122777915-122777937 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913805220 1:122782336-122782358 TTTATGTTCAATGGCAGAAAAGG + Intergenic
913807638 1:122825511-122825533 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913808628 1:122843542-122843564 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913810256 1:122872776-122872798 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913814329 1:122945878-122945900 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913818016 1:123011130-123011152 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913819280 1:123033549-123033571 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913820416 1:123053947-123053969 TTTAAGGTCAATGGCACAAAAGG + Intergenic
913821667 1:123076719-123076741 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913821723 1:123077738-123077760 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913828166 1:123193153-123193175 TTTATGGTCAATGGCAGAAAAGG + Intergenic
913829424 1:123215927-123215949 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913829479 1:123216947-123216969 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913831819 1:123259387-123259409 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913833695 1:123292527-123292549 TTTATGGTCAATGGCAGAAAAGG + Intergenic
913834877 1:123313431-123313453 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913836582 1:123343690-123343712 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913837332 1:123357280-123357302 TTTAAAGTCAATGGCAGAAAAGG + Intergenic
913837450 1:123359314-123359336 TTTATGGTCAATGGCAGAAAAGG + Intergenic
913838467 1:123377328-123377350 TTTAAAGTCAATGGCAGAAAAGG + Intergenic
913841941 1:123439176-123439198 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913842050 1:123441213-123441235 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913842333 1:123446312-123446334 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913846688 1:123525339-123525361 TTTAAAGTCAATGGCAGAAAAGG + Intergenic
913850621 1:123596027-123596049 TTTGTGGTCAATGGCAGAAAAGG + Intergenic
913852213 1:123624581-123624603 TTTACGTTCAATGGCAGAAAAGG + Intergenic
913852327 1:123626621-123626643 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913854524 1:123666055-123666077 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913854794 1:123671154-123671176 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913860109 1:123766498-123766520 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913860171 1:123767516-123767538 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913861389 1:123788936-123788958 TTTATGTTCAATGGCAGAAAAGG + Intergenic
913861505 1:123790975-123790997 TTTAAAGTCAATGGCAGAAAAGG + Intergenic
913861561 1:123791995-123792017 TTTGTGGTCAATGGCAGAAAAGG + Intergenic
913862497 1:123808812-123808834 TTTGTGGTCAATGGTACAAAAGG + Intergenic
913863432 1:123825463-123825485 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913864316 1:123841610-123841632 TTTAAAGTCAATGGCAGAAAAGG + Intergenic
913864870 1:123851802-123851824 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913866759 1:123885459-123885481 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913867327 1:123895655-123895677 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913867438 1:123897682-123897704 TTTATGGTCAATGGCAGAAAAGG + Intergenic
913869352 1:123932179-123932201 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913871610 1:123972625-123972647 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913872689 1:123992330-123992352 TTTGAAGTCAATGGCAGAAAAGG + Intergenic
913874050 1:124016805-124016827 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913874902 1:124032090-124032112 TTTAAAGTCAATGGCAGAAAAGG + Intergenic
913875647 1:124045336-124045358 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913878237 1:124091243-124091265 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913878782 1:124100762-124100784 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913879249 1:124108919-124108941 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913880083 1:124124161-124124183 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913882229 1:124162895-124162917 TTTATGGTCAATGGCAGAAAAGG + Intergenic
913885088 1:124213850-124213872 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913885838 1:124227103-124227125 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913889695 1:124296261-124296283 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913891547 1:124329923-124329945 TTTAAAGTCAATGGCAGAAAAGG + Intergenic
913892421 1:124345564-124345586 TTTGTGTTCAATGGTAGAAAAGG + Intergenic
913893706 1:124368010-124368032 TTTTTATTCAATGGTAGAATAGG + Intergenic
913894643 1:124385003-124385025 TTTCAGGTCAATGGCAGAAAAGG + Intergenic
913897067 1:124428678-124428700 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913903110 1:124537088-124537110 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913904099 1:124554758-124554780 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913906326 1:124594536-124594558 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913906953 1:124605749-124605771 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913907063 1:124607787-124607809 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913910799 1:124674758-124674780 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913911585 1:124689034-124689056 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913913133 1:124716568-124716590 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913913642 1:124725743-124725765 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
913916425 1:124775694-124775716 TTTAAGTTCAATGGCAGAAAAGG + Intergenic
915981934 1:160425776-160425798 TTTCTCTTCAGTGGCCCAACAGG + Exonic
916899315 1:169203294-169203316 TTTGTATTCAACTGTACAAATGG + Intronic
919890470 1:201969693-201969715 TTTCTATTTAAAGGAACAAGCGG + Exonic
920751498 1:208682214-208682236 TTTCTTTTCTATGTTACAAATGG + Intergenic
922909625 1:229204758-229204780 TTTCTCTTCTCTGGCACATATGG + Intergenic
1065310480 10:24411255-24411277 TTAATATTCATTGACACAAAAGG + Intronic
1065687490 10:28301264-28301286 TTTCTATTCAATTCAAAAAAAGG + Intronic
1066509106 10:36075682-36075704 TTTGTATCCAAACGCACAAAAGG + Intergenic
1066927360 10:41714412-41714434 TTTCTTTTCACTGGAAGAAAGGG + Intergenic
1067701893 10:48579861-48579883 TTTCTATTTAATTGCATGAACGG - Intronic
1067819878 10:49519210-49519232 CTTCTACTCAATCCCACAAAGGG + Intronic
1068701925 10:60029923-60029945 TTTCTATTGAATGGCAAGTAAGG - Intronic
1070241598 10:74687465-74687487 TTACTATTAAATGGAACAAAGGG - Intronic
1070733287 10:78846397-78846419 TTTCCCTTAAGTGGCACAAACGG - Intergenic
1071044149 10:81353345-81353367 ATCCTACTCAATGGCAGAAACGG - Intergenic
1071157771 10:82710722-82710744 TTTTTATTTTATGACACAAATGG + Intronic
1071378999 10:85038873-85038895 TTTCTTTACAGTGACACAAAGGG - Intergenic
1071980435 10:90999635-90999657 TTTCTATTTTCTGGCACACAAGG + Intergenic
1072303486 10:94084927-94084949 TTCCTGTTTAATGCCACAAATGG - Intronic
1072474430 10:95746053-95746075 TTTCCCTTCTATAGCACAAAGGG - Intronic
1072890551 10:99320079-99320101 TTTAAAACCAATGGCACAAAGGG - Intergenic
1075121133 10:119665887-119665909 TTTTTATTAAATGGCAAAAATGG + Intronic
1075524428 10:123171169-123171191 TTTGTACTCAATGGCGCAATTGG - Intergenic
1077580482 11:3414126-3414148 TTTCCATCTAATGGCCCAAATGG - Intergenic
1077998341 11:7473294-7473316 TTTCTTTTCAAAGCCAGAAAAGG - Intergenic
1079806407 11:24936101-24936123 TTTCTATTCAATATCGTAAAAGG - Intronic
1080738381 11:35039949-35039971 TTTCTATTTGATAGTACAAAAGG + Intergenic
1080907886 11:36564990-36565012 TTCCTGTTCAATGTCACAGAAGG - Intronic
1081283051 11:41234683-41234705 TTTCTCTTCAAAGCCACATATGG - Intronic
1083095350 11:60244809-60244831 TTTCTATTCTCTAGCAAAAAGGG - Intergenic
1084237414 11:67796955-67796977 TTTCCATCTAATGGCCCAAATGG - Intergenic
1085376593 11:76068118-76068140 TTTCTTCTCAAGGGCCCAAAAGG + Intronic
1085504821 11:77052214-77052236 TTTCTGTTCAATGACACACAAGG + Intergenic
1086163504 11:83749951-83749973 TGTTTATTCAATGGCACAGGTGG - Intronic
1088091659 11:106047131-106047153 TTTCTTTTCAAAGGCAATAATGG - Intergenic
1091655082 12:2340025-2340047 TTCATATTTAATGCCACAAAAGG - Intronic
1092080097 12:5708889-5708911 ATTTTATTCAGTGACACAAATGG - Intronic
1092408073 12:8234547-8234569 TTTCCATCTAATGGCCCAAATGG - Intergenic
1094124455 12:27008557-27008579 TTTCTTTAAAATGACACAAAAGG - Intronic
1097808468 12:63991429-63991451 TTTCTATTTAATGGAGCATAAGG - Intronic
1098346682 12:69512445-69512467 TTTCTACTCAAGGGAATAAAAGG - Intronic
1100916771 12:99432662-99432684 TTTATATTCAATGGTCAAAAAGG + Intronic
1101653578 12:106699468-106699490 TTGCTAATCAATAGAACAAATGG - Intronic
1106891638 13:34252489-34252511 TTTCTATTCTTTGGCATAACAGG + Intergenic
1106984419 13:35328428-35328450 CTAGTATTCAATGGCACAACAGG + Intronic
1108235558 13:48400531-48400553 TTACTATGCTATGGCAAAAAGGG + Intronic
1108784376 13:53877537-53877559 TTTATATACAATAGCAAAAAAGG + Intergenic
1111859853 13:93689167-93689189 TTTCTATTTAATAGCACAAATGG + Intronic
1111902043 13:94211431-94211453 TTTCTATGCTATGAGACAAAAGG - Intronic
1113259956 13:108550982-108551004 TTTCTATAAAAAGGCACAAGGGG - Intergenic
1114074850 14:19155298-19155320 TTTCTATTTATTGTCACAAAAGG - Intergenic
1114087417 14:19244677-19244699 TTTCTATTTATTGTCACAAAAGG + Intergenic
1115087856 14:29538980-29539002 TTTCTGTTCAAGGCCACAGAAGG + Intergenic
1115389063 14:32833308-32833330 ACTCTATTCAAGGACACAAAAGG - Exonic
1115880533 14:37912195-37912217 TTTCTGTTTAGTGGAACAAAAGG + Intronic
1115973764 14:38974360-38974382 CTACTATTCAATAGCACAACAGG - Intergenic
1116715978 14:48428255-48428277 TCTCCATTTAATGGCTCAAAAGG + Intergenic
1116772151 14:49139140-49139162 TTTATCTTCAATGGCTCACAAGG + Intergenic
1118509301 14:66453207-66453229 TTTCTTTTCAGTAGCAGAAATGG + Intergenic
1118591193 14:67402489-67402511 TTACTATTTAATAGCACAACAGG - Intronic
1118744828 14:68766363-68766385 TTTCTACCAAATGGCACAGATGG - Intergenic
1118770528 14:68939880-68939902 TTTCTTTCCAATGGGCCAAATGG - Intronic
1118796171 14:69147330-69147352 TTTCCCTTGAATGTCACAAAAGG - Intronic
1118995797 14:70834664-70834686 GTTATCTCCAATGGCACAAAAGG + Intergenic
1119027071 14:71162323-71162345 CTTCTATTCAATAGCACAGTAGG + Intergenic
1119351881 14:73972750-73972772 TTTCTAGTCACTCGAACAAAAGG - Intronic
1119588082 14:75857142-75857164 TTTCTATTCAACAGCAGTAAAGG - Intronic
1119654784 14:76409569-76409591 TTTCTAATCAATTTTACAAAGGG - Intronic
1119928292 14:78518458-78518480 TTTCTATTTTATGTCACATATGG - Intronic
1121964440 14:98291047-98291069 TTGCTAGTAAATGGCAAAAATGG - Intergenic
1122396890 14:101439971-101439993 TTTCTATAGAATGCCAGAAATGG + Intergenic
1123981112 15:25604636-25604658 TTTCTATTTGATAGCACAATAGG + Intergenic
1127352353 15:58166021-58166043 TTTCTAATGCATGGTACAAATGG + Intronic
1128403067 15:67304986-67305008 CATCTAGTCAATGGCAAAAATGG - Intronic
1129277030 15:74452535-74452557 TTTCACATCCATGGCACAAATGG - Intronic
1130288550 15:82575873-82575895 TTCCTTTTCAATGGGAGAAAAGG + Intronic
1130579421 15:85122532-85122554 TTTCTACTCAACTGCAGAAAAGG + Intronic
1133307699 16:4821261-4821283 TTTCCATTCAATGCCAGCAATGG + Intronic
1133349029 16:5089378-5089400 TTTCCATCTAATGGCCCAAATGG - Intronic
1135458628 16:22621261-22621283 TTTCCGTTAAATGGCACTAAGGG - Intergenic
1135501504 16:22999898-22999920 TTTCCAATAAATGGCACCAATGG - Intergenic
1140640910 16:76971522-76971544 TTTATTTTAGATGGCACAAAAGG + Intergenic
1153122537 18:1746774-1746796 TTTTTCTTCAATTGCATAAATGG + Intergenic
1154211454 18:12382524-12382546 TTTATATCCAAAGACACAAATGG + Intergenic
1155899747 18:31374170-31374192 TTTCAAATCAATGCCACAAAAGG - Intergenic
1156950835 18:42895761-42895783 TCTCTATTAACTGGCATAAAGGG + Intronic
1157328539 18:46686467-46686489 TTACTATTAGATGGCACCAAAGG + Intronic
1159232787 18:65630440-65630462 TTTATATGCAATGACCCAAATGG + Intergenic
1159523714 18:69560507-69560529 TGTGTATTCAATGGAATAAACGG + Intronic
1159778175 18:72628250-72628272 TTTCTATTTAATGTCAGAACTGG - Intronic
1159998056 18:74986514-74986536 CTACTATTCAATGGCTGAAATGG - Intronic
1160051406 18:75437520-75437542 ATGCTATTCAATAGCACAACAGG + Intergenic
1164077297 19:21831909-21831931 TTTCTATTCATGAGCATAAACGG - Intronic
1165528620 19:36378038-36378060 TATCTATTGACTGGCAGAAAGGG + Intronic
1166407886 19:42535036-42535058 CTACTATTCAATAGCACAAGGGG - Intronic
1167030930 19:46959780-46959802 TTACCTTTAAATGGCACAAAAGG - Intronic
1168594140 19:57661550-57661572 TATTTATTCAATGGCATAAGTGG + Intergenic
925139238 2:1538390-1538412 TTTCTATACAATTGCATATATGG - Intronic
926404642 2:12538836-12538858 TATCTATTCAGTGGCAGAACTGG + Intergenic
928670039 2:33593596-33593618 TCTCTATTCACTATCACAAAGGG + Intronic
928735968 2:34289427-34289449 TTTCCATTCAATAGCAGTAATGG + Intergenic
928851456 2:35752582-35752604 TTTCTATTTGATAGCACAACAGG - Intergenic
930796165 2:55393906-55393928 TTTCTATTCAATGTCTGAATGGG + Intronic
931509206 2:62971433-62971455 TCTGTATTCATTGACACAAAGGG + Intronic
931983419 2:67718742-67718764 ATTCTGCTCCATGGCACAAAAGG + Intergenic
932509829 2:72274980-72275002 TTTTTATTCAGTGTGACAAAGGG + Intronic
937530361 2:122820207-122820229 ATTCTATTCAATGACAGAGATGG - Intergenic
938489174 2:131751786-131751808 TTTCTATTTATTATCACAAAAGG - Intronic
938640690 2:133275711-133275733 TTTCAGCTCAAAGGCACAAAAGG + Intronic
939080865 2:137660314-137660336 ATTCTAATCAATGGCACTCATGG + Intronic
939198442 2:139002963-139002985 TTTCTCTTCAGTGACAGAAAAGG - Intergenic
940173749 2:150856072-150856094 ATTTTATTTAATGTCACAAACGG - Intergenic
941913851 2:170794928-170794950 ATTTTATTCAATGGCTCTAAAGG - Intronic
942084757 2:172433445-172433467 TAGCTAGTCAATGGCAGAAAAGG - Intronic
942345044 2:174994091-174994113 TTTCATTTCAGTGGTACAAAGGG - Intronic
943088030 2:183337945-183337967 TTTTAAGTCAATGGCAAAAATGG + Intergenic
943844365 2:192624804-192624826 TTTCTATTCAATGAAATAAATGG - Intergenic
944155632 2:196604332-196604354 CTACTATTCATAGGCACAAAGGG - Intergenic
946117911 2:217479675-217479697 TTGGTTTTCTATGGCACAAATGG - Intronic
946735984 2:222755074-222755096 ATTCTATAAAATGGCATAAAGGG + Intergenic
946766847 2:223048612-223048634 TTTCCATTCAGTGAGACAAAAGG + Intergenic
1169589716 20:7126753-7126775 TTTCTAATCAGTGGCAAAAGGGG - Intergenic
1172453710 20:35048854-35048876 TTTTTATCAAAGGGCACAAAGGG + Intronic
1178315895 21:31566646-31566668 TTTCTCTTCACTGACACACAAGG + Intergenic
1178473133 21:32912642-32912664 TTTCTATTCAATGATACAGTAGG - Intergenic
1180290500 22:10848232-10848254 TTTCTATTTATTGTCACAAAAGG - Intergenic
1180493299 22:15877653-15877675 TTTCTATTTATTGTCACAAAAGG - Intergenic
1181330255 22:22085627-22085649 TTTTTATTGAATAGCAAAAATGG - Intergenic
949677640 3:6475150-6475172 TTTATCCTGAATGGCACAAAGGG - Intergenic
950375096 3:12564837-12564859 TTTATATGCAATGTCAGAAAAGG - Intronic
951871221 3:27364612-27364634 TTTAAATTCAATGTCACAAATGG + Intronic
951995049 3:28718189-28718211 TTTCTACTCATTTGTACAAACGG + Intergenic
952181667 3:30923170-30923192 TTTCTTTTTAATGGCGAAAATGG - Intergenic
953568833 3:44055761-44055783 TTTCCCTCAAATGGCACAAAAGG + Intergenic
956142275 3:66157875-66157897 TTTCTATTCAAATTCAGAAAAGG + Intronic
956621904 3:71229697-71229719 TTTCTAGTCAATGTCAAGAATGG + Intronic
957053354 3:75426721-75426743 TTTCCATCTAATGGCCCAAATGG - Intergenic
957945042 3:87052916-87052938 TTTCTGTTAAATGACACTAAAGG - Intergenic
958779161 3:98521198-98521220 TTTCGATACAATGGCACAGTGGG - Exonic
959115664 3:102175066-102175088 TTTCTATTCAATTAAGCAAATGG + Intronic
960187018 3:114655591-114655613 TTTCCATTCAATTGCACAACTGG + Intronic
962580078 3:136790233-136790255 TATCTAGTCAATGTCCCAAAAGG - Intergenic
963440999 3:145340044-145340066 TTTCTAGTCAATAGCATGAAAGG + Intergenic
964194691 3:154049061-154049083 TTTCTATTTGATAGCACAATAGG + Intergenic
965274295 3:166661156-166661178 TTACTATTTGATAGCACAAAAGG - Intergenic
966312388 3:178608592-178608614 CTACTATTCAATAGCACAATAGG - Intronic
967640655 3:191858826-191858848 TTTGTATTCAAAGGGAGAAATGG + Intergenic
969757833 4:9161659-9161681 TTTCAATCTAATGGCCCAAAAGG + Intergenic
969817813 4:9699201-9699223 TTTCCATCTAATGGCACAAATGG + Intergenic
971286904 4:25299581-25299603 TTTCTGTTCCATGGCATATAAGG + Intergenic
971481003 4:27114891-27114913 TTTCTATTATATGAAACAAAGGG + Intergenic
971543095 4:27846840-27846862 TTTCTATATCATGGCACCAATGG + Intergenic
971621858 4:28864504-28864526 TTTCTGGTCAATGACTCAAATGG - Intergenic
972417455 4:38855782-38855804 TTTCTATTTATTGGGAAAAAAGG + Intronic
972931819 4:44081123-44081145 TATCTACTCAGTGTCACAAAAGG - Intergenic
973880494 4:55266856-55266878 CTACTATTCAATAGCACAACAGG + Intergenic
975443381 4:74437250-74437272 TTTCTATTCAAAGGGAAAAAAGG + Intergenic
976550560 4:86390238-86390260 GTTTTATTCAATGGTAGAAAAGG + Intronic
976653637 4:87463237-87463259 GTTATATTCAATGCCACGAAAGG - Intergenic
978764311 4:112389011-112389033 TTTCCATTCAGGGGCACACAAGG + Intronic
981018426 4:140000086-140000108 TTTCTCTTCAAAGTCACAATGGG + Intronic
981457455 4:144970111-144970133 ATTCTACTCAAAGGCACAAAGGG - Intronic
981609859 4:146581685-146581707 TATCTATTCAATGTGACAGAAGG + Intergenic
983911865 4:173248604-173248626 CTTCAATACAATGGCATAAATGG - Intronic
987979614 5:25064820-25064842 TTTTTTTCCAATGGCAAAAAGGG + Intergenic
988890332 5:35609704-35609726 TGCCTATCCAATGGCATAAAAGG + Intergenic
990109078 5:52301082-52301104 TTTCTATTCAATTTCCCTAAAGG - Intergenic
991155639 5:63431674-63431696 ATGGTATTCAATTGCACAAAGGG + Intergenic
991477890 5:67043039-67043061 TTTCTGTTGAATGTCATAAAAGG + Intronic
992892149 5:81213397-81213419 CTTCTATTCTCTGGCACCAATGG - Intronic
993805431 5:92402365-92402387 TTTTTATACAATGGTACAGACGG + Intergenic
993862642 5:93155199-93155221 TATCTATTAAATGGAAAAAAAGG - Intergenic
994101414 5:95897042-95897064 ATACTATGTAATGGCACAAAAGG - Intronic
994944853 5:106374420-106374442 TTTCTGTTGAGTGGCACAAAAGG - Intergenic
995203538 5:109453325-109453347 TTTCTATTCAACAGAACAAAAGG - Intergenic
995406300 5:111800401-111800423 CTTCTGTGCAATGGCACAAGTGG - Intronic
995452118 5:112313606-112313628 TTGCTAGTCCAAGGCACAAAAGG - Intronic
995642014 5:114267664-114267686 TTTTTATTTAATAGGACAAAGGG - Intergenic
998125493 5:139617583-139617605 TTTCTACTTAATGGTTCAAATGG - Intronic
998561031 5:143171703-143171725 TTTGTTTTTAATGGCAGAAATGG - Intronic
1000195407 5:158952337-158952359 ATTATATTCCACGGCACAAAGGG + Intronic
1000647116 5:163772332-163772354 TTTGTATTCAATGCACCAAATGG - Intergenic
1001205404 5:169757630-169757652 TTTCTATGCAATGGAACAACAGG + Intronic
1001773563 5:174312637-174312659 ATTCTACTCAATCTCACAAAAGG - Intergenic
1002351504 5:178586750-178586772 TTTGAATTCCATGGCACAACTGG - Intronic
1002583927 5:180229394-180229416 TTTCTATTAAATCACACCAAAGG - Intergenic
1003050242 6:2774048-2774070 TTTCTATTCAATGGCACAAAAGG - Intronic
1004594258 6:17084332-17084354 TTTCTATTCAGTAGCACAATAGG - Intergenic
1004737701 6:18424327-18424349 TTTCTATTCAAAGGCAAAGAGGG - Intronic
1006483206 6:34315511-34315533 TCACTATTCAATGGCATTAAAGG + Intronic
1009499989 6:64400168-64400190 TTTCTATTCATTGTCACAGAAGG + Intronic
1009930185 6:70167895-70167917 TTTCTATTCTATTTTACAAAGGG - Intronic
1010338220 6:74714675-74714697 TTCCTTTTCACTGGGACAAATGG + Intergenic
1010588482 6:77684410-77684432 CTACTATTCAATAGCACAATAGG - Intergenic
1011505196 6:88034000-88034022 TTTCTAGCCAGTAGCACAAATGG - Intergenic
1012728801 6:102852831-102852853 TTTATATAAAATGGCAGAAAGGG + Intergenic
1012831458 6:104208625-104208647 TTGCCATTTAATGGCAAAAACGG - Intergenic
1013253546 6:108359715-108359737 TTTCAACTAAATGGCACAGAGGG + Intronic
1013772929 6:113647587-113647609 ATTCTATTATATGGCAAAAAAGG + Intergenic
1015680214 6:135799193-135799215 TTGCTATTCAAAGACTCAAAGGG - Intergenic
1015828165 6:137338008-137338030 TGGCTATTCAATGGCAGAACTGG + Intergenic
1016047260 6:139493591-139493613 ATTTTCTCCAATGGCACAAATGG + Intergenic
1016798872 6:148147692-148147714 TTCCTATTCGATGACACAAAGGG - Intergenic
1018020695 6:159760439-159760461 TTTCTATTTTATGGTAGAAACGG + Exonic
1019074378 6:169376270-169376292 TTTTCATTCAATGGAAGAAAAGG - Intergenic
1019752776 7:2742831-2742853 TTTCTATTCACTAGCAACAAAGG - Intronic
1020320432 7:6935449-6935471 TTTCCATCTAATGGCCCAAATGG - Intergenic
1020504136 7:8961945-8961967 ATTGTATTTGATGGCACAAAAGG + Intergenic
1021350215 7:19583818-19583840 CTACTATTCAATAGCACAATAGG + Intergenic
1021744342 7:23723498-23723520 TTTATATTCAATAGAAGAAAAGG - Intronic
1022334107 7:29406517-29406539 GTTCTATTCAATAGTAGAAAAGG - Intronic
1022403763 7:30066811-30066833 TTTCTATTCTGTGCCAGAAAAGG - Intronic
1022641784 7:32193250-32193272 TTTATATTTAAGGGCAAAAACGG - Intronic
1023487794 7:40705523-40705545 TTTCTAGTCAGTGTCAAAAATGG - Intronic
1024976122 7:55115534-55115556 TTTATAATCAATGGCAGTAAGGG + Intronic
1025566864 7:62446157-62446179 TTTCCATTCAATGGTTCCAAAGG + Intergenic
1026737042 7:72955473-72955495 TTTCTGTGTAATGGCAGAAAAGG + Intergenic
1027106690 7:75409595-75409617 TTTCTGTGTAATGGCAGAAAAGG - Intronic
1027922946 7:84419240-84419262 TTTGTATTGATTGTCACAAAGGG - Intronic
1028001103 7:85499690-85499712 TTTCTATTTAATGGCACCATAGG - Intergenic
1030123615 7:106134179-106134201 TTTCAAATCAAGGGCACAGAGGG - Intergenic
1031570230 7:123350145-123350167 TTAGTGTTCAATGGCACAATAGG - Intergenic
1032882132 7:136101063-136101085 TTTTTTTTCAATGGCAAAAAGGG - Intergenic
1033459236 7:141530361-141530383 TTTCTATTCAATTGCACAAGGGG + Intergenic
1033853279 7:145524360-145524382 TTTCGTGTCAATGGCAAAAATGG + Intergenic
1036381087 8:8236982-8237004 TTTCCATCTAATGGCTCAAATGG + Intergenic
1036848483 8:12185647-12185669 TTTCCATCTAATGGCCCAAATGG - Intronic
1036869843 8:12427928-12427950 TTTCCATCTAATGGCCCAAATGG - Intronic
1037462543 8:19127209-19127231 TTACTATTCTGTGGGACAAAGGG - Intergenic
1037696477 8:21228418-21228440 AGTCTATTCAAAGACACAAATGG + Intergenic
1039358360 8:36846440-36846462 TTTCCACTTAATGGCAGAAAAGG + Intronic
1042123995 8:65518802-65518824 GTTCTATTCAATAGCACAGTAGG + Intergenic
1042445649 8:68882426-68882448 ATTCTATCCTATGGCACTAATGG - Intergenic
1042927040 8:73976759-73976781 CTTCTACTCAAGGGCAGAAAAGG - Intronic
1043630077 8:82320040-82320062 TTTCTCTGCCATGGCACATAAGG + Intergenic
1043764129 8:84107595-84107617 TTGATATTCAAAGGTACAAATGG + Intergenic
1043983865 8:86671206-86671228 GTGCTATTCAATTGCAAAAAAGG - Intronic
1044263127 8:90151374-90151396 TTTCTATCAAATGGCAAGAAGGG + Intergenic
1045314260 8:101029548-101029570 TTTCTATTTAGTGCCACAAATGG + Intergenic
1045739443 8:105338632-105338654 GCTCTAGTGAATGGCACAAAAGG - Intronic
1045780678 8:105859510-105859532 CTTCTATTCAATAACAAAAATGG + Intergenic
1046663922 8:116978363-116978385 TTTCTATTCAATGATGCAAATGG - Intronic
1048430500 8:134366128-134366150 TATCTGTCCAATGGGACAAAAGG + Intergenic
1051566175 9:18500975-18500997 TTTTAATTCAATGTCTCAAAAGG - Intronic
1051617095 9:19016671-19016693 TTTCTAATCTGTGGCACCAATGG - Intronic
1052087762 9:24289472-24289494 ATTCTATTTAATGGCACATGTGG + Intergenic
1052097319 9:24398837-24398859 TTTCTATTAAATAGTATAAATGG + Intergenic
1052418126 9:28204039-28204061 TTTTTATTGAATGCCACAAAGGG + Intronic
1054843412 9:69767553-69767575 ATTGTAATAAATGGCACAAAAGG + Intergenic
1055401834 9:75932462-75932484 TTTCATTTCAATGGAACCAAAGG + Exonic
1057409738 9:94807555-94807577 TTTCTTTGCAATGGAAAAAATGG - Intronic
1059125059 9:111676653-111676675 TCTATATTAAATGGCAAAAAAGG - Intergenic
1061426863 9:130504841-130504863 TGTCTATTCAATGGAATGAAGGG - Intergenic
1203340162 Un_KI270310v1:11-33 TTTCAGGTCAATGGCAGAAAAGG - Intergenic
1186390789 X:9156751-9156773 ATACTATTGAATGGCACAACAGG + Intronic
1187280378 X:17854255-17854277 TTACTATTAATTGGCACAATGGG - Intronic
1188001085 X:24982694-24982716 TTTTTTTTTAATAGCACAAATGG + Intronic
1192611739 X:72573414-72573436 GCGCTATTTAATGGCACAAATGG + Intergenic
1194240662 X:91443376-91443398 TTAATTTTCTATGGCACAAATGG + Intergenic
1194757477 X:97754304-97754326 TTTCAAATCAATGCCAGAAAGGG + Intergenic
1194903546 X:99544295-99544317 TTACTATTCGATAGCACAACAGG - Intergenic
1195869510 X:109471463-109471485 TTTTTGTCCAATGGCACAAAAGG - Intronic
1196056390 X:111360518-111360540 TTACTATTTGATGGCACAACAGG + Intronic
1196320136 X:114277233-114277255 TTTCTTCTCAATGACACATAAGG + Intergenic
1196491103 X:116268029-116268051 TGTCTATTCAATGGCAGATTTGG - Intergenic
1197104474 X:122697858-122697880 TTTAGATTCAAAGGTACAAATGG - Intergenic
1198856531 X:141023242-141023264 TTTAGATTCAAAGACACAAATGG + Intergenic
1198906161 X:141564125-141564147 TTTAGATTCAAAGACACAAATGG - Intergenic
1199432141 X:147773644-147773666 ATTCTATGCACTGGGACAAAGGG - Intergenic
1201298699 Y:12487742-12487764 TTTCTATTCCAGGGCACTTAGGG - Intergenic
1201986025 Y:19966534-19966556 TTACTATTTAATAGCACAAAAGG + Intergenic