ID: 1003050649

View in Genome Browser
Species Human (GRCh38)
Location 6:2778009-2778031
Sequence GGTGAGATGAGGCATCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003050641_1003050649 18 Left 1003050641 6:2777968-2777990 CCCACAAGGAATAACTGGAAATC 0: 1
1: 0
2: 2
3: 9
4: 204
Right 1003050649 6:2778009-2778031 GGTGAGATGAGGCATCTTTAAGG 0: 1
1: 0
2: 0
3: 16
4: 176
1003050642_1003050649 17 Left 1003050642 6:2777969-2777991 CCACAAGGAATAACTGGAAATCA 0: 1
1: 0
2: 0
3: 19
4: 224
Right 1003050649 6:2778009-2778031 GGTGAGATGAGGCATCTTTAAGG 0: 1
1: 0
2: 0
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003050649 Original CRISPR GGTGAGATGAGGCATCTTTA AGG Intronic
900435080 1:2626448-2626470 GGTGAGATGAAGCATGTATGTGG - Intronic
900579515 1:3402173-3402195 GGGGGGATGAGGCATCTTGTTGG + Intronic
903656551 1:24952311-24952333 GGTGAGATGATGCATCTGGAAGG - Intronic
903746612 1:25591153-25591175 GGTCAGATGAGGCCTCTCTGAGG - Intergenic
913034627 1:114951760-114951782 GGCAATATGAGGAATCTTTATGG - Intronic
916363624 1:163999044-163999066 TGTGAGAGGAGGCATGATTAAGG + Intergenic
917793710 1:178516542-178516564 GGTTAGTTGTGGCATCTTTCAGG - Intronic
917799890 1:178560929-178560951 GATGAGATCAGGCATGTTCAGGG - Intergenic
919342180 1:196325663-196325685 GGAAAGCTGAGGCATATTTAGGG - Intronic
923320544 1:232828549-232828571 GGTGACAGTGGGCATCTTTAAGG - Intergenic
1064993472 10:21276470-21276492 GGTGAGAAGAGGCTTCTGTGAGG - Intergenic
1071419604 10:85478793-85478815 GATGAGGTGAGGCATCTAGATGG + Intergenic
1072808948 10:98445119-98445141 GGAGAGATGAGGCATCAGGATGG + Intronic
1075859882 10:125666483-125666505 GGTGTGATGTGTCATGTTTACGG + Intronic
1077678927 11:4221893-4221915 GGTGAAATGGGGGAACTTTAAGG + Intergenic
1079030741 11:16984579-16984601 GGTCAGAAGAGGCCTCTTTGTGG - Intronic
1079755808 11:24259779-24259801 GGTGACATTAAGCATCTTTATGG - Intergenic
1081547844 11:44084372-44084394 AGTCAGGAGAGGCATCTTTATGG + Intergenic
1081736900 11:45410616-45410638 GGTGACTTCACGCATCTTTAGGG + Intergenic
1083872711 11:65499306-65499328 GTTGAGATGAAGCTTCTTCATGG + Intergenic
1085143649 11:74172113-74172135 GGTGAGATTAGGTCTCTTAAGGG + Intronic
1086342144 11:85857526-85857548 GGGGATGTGAGGCATCTTCAAGG + Intronic
1086950904 11:92889363-92889385 GATGAGATGTGGGATATTTATGG + Intronic
1087194722 11:95293761-95293783 GGTGAGATGCAGCATGTTCAGGG + Intergenic
1087553440 11:99682420-99682442 GGTGGGAGGAAGCAGCTTTAGGG + Intronic
1088536662 11:110868868-110868890 GCTGAGATGAAGCTCCTTTAGGG - Intergenic
1089482044 11:118813928-118813950 GGTGAGATGTGTCATCTTCTGGG - Intergenic
1091027325 11:132153398-132153420 GGTTGGATGAGGTCTCTTTATGG + Intronic
1091358291 11:134955090-134955112 GTTTACATCAGGCATCTTTATGG + Intergenic
1091848612 12:3677547-3677569 GGTGAGCTGAGGCACCGTAACGG - Intronic
1092238035 12:6821948-6821970 GGGGAGAGGAGGCAGCTTGAGGG - Intronic
1092787929 12:12046180-12046202 GGCAAGATGAGGGAACTTTATGG + Intergenic
1092848004 12:12601943-12601965 GGTGTGAGGAAGCATCTTTTCGG + Intergenic
1093095989 12:14972974-14972996 GGTGAGATTAGGCAGCATGAGGG + Intergenic
1093978581 12:25450987-25451009 TGTGAGATGATGCCTCATTATGG - Intronic
1096358429 12:50962769-50962791 GGCCAGAGGAGGCTTCTTTAAGG + Intronic
1105548517 13:21369861-21369883 GATGACATCAGGCATGTTTAGGG + Intergenic
1106630490 13:31467179-31467201 GGGGAGAGGAGGAATCTTTGAGG - Intergenic
1106924765 13:34602096-34602118 GGTCAGAGGAGGCTTCTTTTAGG - Intergenic
1107570359 13:41650933-41650955 GGTCTGATAAGGCATATTTAAGG + Intronic
1110838623 13:80114575-80114597 GGTGAGATGATACCTCATTATGG + Intergenic
1113926642 13:113945190-113945212 TGTGTGATGAGGCATCTTCCCGG + Intergenic
1115861640 14:37692988-37693010 GGTGAGAGTGGGCATCTTTCAGG - Intronic
1115864115 14:37723865-37723887 GGAGAGATCACGCATATTTAGGG + Intronic
1117845015 14:59901873-59901895 GGTGAAATGAGGCATTTCTAGGG - Intergenic
1118060348 14:62131196-62131218 GGTGACAAGAGCCATCCTTATGG + Intergenic
1120331759 14:83102391-83102413 GTTGAGATGCAACATCTTTATGG - Intergenic
1120762529 14:88298486-88298508 GGAGAGGTGGGGCATCTCTAAGG - Intronic
1126063368 15:44805413-44805435 AGAGAGATGAGCCATCTTTAAGG + Intergenic
1126830108 15:52593219-52593241 GGTGACATAAGGCTTCTGTATGG - Intronic
1133243215 16:4428699-4428721 GGTGAGAGGTGGCATCCTTCAGG + Intronic
1133590144 16:7234336-7234358 GTTGAGATGAGGAATCTATTTGG + Intronic
1137249202 16:46730263-46730285 GGTGAGGAGAAGCTTCTTTAGGG - Intronic
1137459177 16:48643148-48643170 GGTGAGATGATACATCATTGTGG + Intergenic
1137650679 16:50117548-50117570 GGTGAAATGATGCCTCATTACGG - Intergenic
1138113782 16:54344420-54344442 GGTGTGATCAGGTTTCTTTACGG + Intergenic
1140713503 16:77700893-77700915 AGAGAAATGAGACATCTTTAAGG - Intergenic
1140894164 16:79310549-79310571 GGTGAGATGAGCCACCTCTTTGG - Intergenic
1141700134 16:85638677-85638699 GGTGAAAGGAGGCAGCATTAGGG - Intronic
1142946208 17:3430721-3430743 GGTGAGATGAGGTCTCATTTTGG - Intergenic
1144352358 17:14409489-14409511 GGTGTGATGAGGCATGGTTATGG + Intergenic
1144812980 17:18013091-18013113 GGTGAGATGATGCCTCATTCTGG - Intronic
1145183744 17:20776005-20776027 GGTGATATGACGCATGTTGAAGG + Intergenic
1148782037 17:50127985-50128007 GGGGAGATGAGACCTATTTAAGG - Intronic
1150487765 17:65555889-65555911 GTTGAGATGAAGCATCTTAAAGG - Intronic
1154496648 18:14966148-14966170 GTTTACATCAGGCATCTTTATGG - Intergenic
1156790056 18:40961176-40961198 GGGAAGATGTGCCATCTTTATGG + Intergenic
1157160117 18:45306287-45306309 GATGATATGAGGTACCTTTATGG - Intronic
1157707956 18:49824195-49824217 GGCTAGAAGAAGCATCTTTAGGG - Exonic
1158530967 18:58260813-58260835 GGTGAGAGAAGGCTTCTTTGGGG + Intronic
1159135332 18:64330658-64330680 TGTGAAATGAAGAATCTTTAAGG + Intergenic
1159903028 18:74065949-74065971 GGTGGGATGAGCGATCCTTAAGG + Intergenic
1159952372 18:74494848-74494870 GATGAGATTAGGCATGTTCAGGG - Intergenic
1160047572 18:75400981-75401003 GCTGACAGGAGGCATCTTTTAGG + Intergenic
1160096061 18:75874714-75874736 GTGGACATGAGGCATCTTGAAGG - Intergenic
1161738007 19:6003444-6003466 GGTGAGAGGAGGCAGCTGCAGGG - Intronic
1166900070 19:46053820-46053842 GGTGAGATGATACCTCATTATGG + Intronic
1166953389 19:46445478-46445500 AGTGAGATGAGGAAGCTCTAGGG + Intergenic
1167691077 19:50983829-50983851 GGTGAGAAGAGGCTTCATCAAGG - Intronic
1168322403 19:55518088-55518110 GGTGGGATGAGGCATCGTGGTGG - Exonic
1168368085 19:55806695-55806717 AGTGAGGTGAGGCATTTTGAGGG - Intronic
926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG + Intergenic
927586193 2:24307893-24307915 GTTCAGATGAGGTATCTTTTAGG - Intronic
930179782 2:48342703-48342725 GATGAGATCAGGCATGTTCAGGG - Intronic
931459290 2:62436311-62436333 GGTTAGAGGAGGCTTCTTTGAGG + Intergenic
935895258 2:107730216-107730238 GGTGATATGAGGGATCCTTGTGG + Intergenic
935984517 2:108659911-108659933 GGTCAGAGGTGGCATCTCTATGG + Intronic
936136953 2:109903559-109903581 GGTCAGAGGTGGCATCTCTATGG + Intergenic
936207744 2:110467926-110467948 GGTCAGAGGTGGCATCTCTATGG - Intronic
937081164 2:119141006-119141028 GGTGAGAGCAGGCCTCTTTGAGG + Intergenic
938662725 2:133504197-133504219 GGTTATATGAGGAATCTTTCTGG + Intronic
944337002 2:198545907-198545929 GGTGAAATCAAGCATCATTAGGG - Intronic
945711880 2:213307112-213307134 GGTGAGTTGAGGCAAATTTTGGG - Intronic
946239561 2:218345329-218345351 AGTGAGATGAGGCCTCCTGACGG - Exonic
1170159307 20:13296104-13296126 GGTAAGATGAGGCATATCTAAGG - Intronic
1171191186 20:23160933-23160955 GCTGAGATGGGGCATGTTCAGGG + Intergenic
1171943076 20:31349588-31349610 GGTGAGATGAAGGAAATTTAGGG + Intergenic
1172229970 20:33330036-33330058 GATGAGACGAGGCACCTCTAGGG - Intergenic
1172623852 20:36336412-36336434 GGTGAGAGGAGGGCTCTTTGAGG - Intronic
1173087428 20:39937220-39937242 GGAGAGATGAGGCATGATTCAGG - Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1180168911 21:46047397-46047419 GATGATATGAGGGATCTTTTTGG + Intergenic
1180168917 21:46047436-46047458 GATGATATGAGGGATCTTTTTGG + Intergenic
1180168935 21:46047547-46047569 GATGATATGAGGGATCTTTTTGG + Intergenic
1180168948 21:46047625-46047647 GATGATATGAGGGATCTTTTTGG + Intergenic
1180169008 21:46047972-46047994 GATGATATGAGGGATCTTTTTGG + Intergenic
1180169043 21:46048200-46048222 GATGATATGAGGGATCTTTTTGG + Intergenic
1180169073 21:46048389-46048411 GATGATATGAGGGATCTTTTTGG + Intergenic
1180169084 21:46048466-46048488 GATGATATGAGGGATCTTTTTGG + Intergenic
1180169148 21:46048812-46048834 GATGATATGAGGGATCTTTTTGG + Intergenic
1180169154 21:46048851-46048873 GATGATATGAGGGATCTTTTTGG + Intergenic
1184431558 22:44444161-44444183 GGGGTGATGGGGCATCTTCATGG + Intergenic
1185314684 22:50173981-50174003 GTTGGGATGTGGCATCTTTGGGG + Intronic
951800380 3:26589205-26589227 AATGAGGTGAGGAATCTTTATGG - Intergenic
952523988 3:34190490-34190512 AGATAGATGAGCCATCTTTAAGG - Intergenic
952953306 3:38541709-38541731 GGTGAGATGAGGCTGCTAGAGGG + Intronic
953303224 3:41800110-41800132 GGTAAGATGAAGCATCTTTTGGG - Exonic
955864301 3:63366301-63366323 GGTGATAAGAGGAATATTTATGG + Intronic
956057354 3:65314219-65314241 GATGATATGAACCATCTTTAAGG - Intergenic
956650520 3:71500624-71500646 GGAGAGAGGGGACATCTTTAAGG - Intronic
959442884 3:106400280-106400302 GGTGAGAAGAGTCATATTTCTGG + Intergenic
961052357 3:123757632-123757654 AGTGAGCTGAAGAATCTTTAGGG + Intronic
961806024 3:129489866-129489888 GGAGGGAGGAGGCATCTCTATGG + Intronic
961857859 3:129891152-129891174 AGTGAGAGGAGGCCTCATTAAGG - Intronic
962192728 3:133328373-133328395 GGTGAGATCAGGCACATTCAGGG + Intronic
962482882 3:135812843-135812865 GGTGAGATGAGGCATAAAGAAGG + Intergenic
963103349 3:141625369-141625391 CGTCAGATGTGGCATCTTTGAGG - Intergenic
963285520 3:143431147-143431169 GGTGAGATGAGAAAGATTTAGGG - Intronic
964862035 3:161213458-161213480 GGTAATATGAGGAATCTTTATGG - Intronic
965121891 3:164570084-164570106 GGTGAGATGATGTATCTTCGTGG - Intergenic
966568726 3:181415163-181415185 GTTGAAATGAGTCATCTTTAAGG - Intergenic
969021300 4:4142170-4142192 GGAGAGATGGGGCAAGTTTAGGG + Intergenic
970904220 4:21196478-21196500 GCTAAGATGAGGCATCTGCATGG - Intronic
978659326 4:111104807-111104829 GGTGAGATGAGATATGTGTAAGG + Intergenic
978842668 4:113233049-113233071 GGTGAGAAGAGGCATGTCTCAGG - Intronic
983428997 4:167623247-167623269 GGTGATGTGAGGCATTTTTTTGG - Intergenic
984105643 4:175541830-175541852 CCTGGGATGAGGCAGCTTTAAGG + Intergenic
986956834 5:13161098-13161120 GGGGAGATGAACCAACTTTATGG - Intergenic
987909615 5:24124426-24124448 GGTGAGAGGAGGGAACTTAAAGG - Intronic
990864170 5:60362322-60362344 GGTCAGATGAGTCATCTTTTGGG + Intronic
990947593 5:61265086-61265108 GGGGTGAAGAGGCATCTTTTTGG - Intergenic
994106846 5:95959275-95959297 GGTGGGAAGAGGCATCTCTGGGG - Intronic
997771296 5:136556736-136556758 GGGTAGATGAGGCAGCTTCAAGG + Intergenic
998627948 5:143866856-143866878 GGTGAGGTGAGGGAACTTAAAGG - Intergenic
999477608 5:151915258-151915280 GCTGAGATGGGGCATCCTGAGGG + Intronic
1000462882 5:161544937-161544959 GAGGAGATGAGGCTTCTGTAGGG + Intronic
1001267982 5:170288864-170288886 GGTGAAAGGAGGCATCTGGAAGG + Intronic
1002260978 5:177993986-177994008 GGTGAGATGAGGCCTGTGTCTGG + Intronic
1003050649 6:2778009-2778031 GGTGAGATGAGGCATCTTTAAGG + Intronic
1006636889 6:35467595-35467617 GGTGAGAATGGGCATCTTAAAGG + Intergenic
1008039125 6:46777197-46777219 TTTCAGAGGAGGCATCTTTAGGG + Intergenic
1009542050 6:64972554-64972576 GGAGAATTGAGTCATCTTTAAGG - Intronic
1010471379 6:76232299-76232321 GATGAGATTGGGCATGTTTAGGG + Intergenic
1010843655 6:80678554-80678576 GATGAGATCAGGCACATTTAGGG - Intergenic
1011256662 6:85429015-85429037 TATGAGATGATGCATCTTTGTGG - Intergenic
1011272880 6:85597419-85597441 TGTGATAGGAGGCATCTGTAAGG - Intronic
1011665133 6:89626107-89626129 GGTAAGATGAAACATTTTTAAGG + Intronic
1015514885 6:134073807-134073829 GGGGAGATGAGGTGTGTTTATGG + Intergenic
1017116582 6:150983060-150983082 TGTGAGATTTAGCATCTTTATGG + Intronic
1017848361 6:158279927-158279949 AGTGAGGTGATGCTTCTTTACGG + Intronic
1019214851 6:170436887-170436909 GGGGTGATGTGGCATGTTTAGGG + Intergenic
1022337547 7:29436027-29436049 GGGCAGATGTTGCATCTTTAGGG - Intronic
1026362748 7:69617760-69617782 GGAGACATGGGGCATCTTTTTGG + Intronic
1026911751 7:74095158-74095180 GATGAGATGAGGGACCTTAAGGG - Intronic
1028153661 7:87405385-87405407 GGCAATATGAGGGATCTTTATGG + Intronic
1028957586 7:96711433-96711455 GATGAGATGGGGCATGTTCAGGG + Intergenic
1033354309 7:140586991-140587013 GGTGAGTTCAGTCATCTTCAGGG - Intronic
1033709176 7:143921691-143921713 GATGAGATCAGGCATATTTTGGG - Intergenic
1038881101 8:31612898-31612920 TGTGATATGAGTCATATTTATGG - Intergenic
1040780629 8:51104372-51104394 GGTGAAATCAGCTATCTTTAGGG + Intergenic
1041082678 8:54228202-54228224 GGTGAGAGGAACCATCTTCAGGG + Intergenic
1041958671 8:63586025-63586047 GGTGAGATGAGGCAAGTGTGGGG + Intergenic
1046049151 8:109000643-109000665 GGTGAGATGTGGCATCATCTAGG - Intergenic
1046298115 8:112248507-112248529 GATGAGATAAGGGATATTTAGGG + Intronic
1047958251 8:129992179-129992201 GGTGTGATGATGCATGTCTATGG + Intronic
1048008348 8:130437293-130437315 TGTGAGCTGGGGCATCTTGAAGG - Intronic
1049233451 8:141496062-141496084 GGTGAGCTGGGGCATCATTTGGG + Intergenic
1051759594 9:20447228-20447250 AGTGATATAAGGCATCTTGATGG + Intronic
1053158212 9:35794434-35794456 GGAGAGGTGAGGCATCGTTCTGG + Intronic
1053650770 9:40167115-40167137 GGTTAGAAGAAGCATCTTTAGGG - Intergenic
1053754966 9:41296809-41296831 GATTAGAAGAAGCATCTTTAGGG + Intergenic
1054331279 9:63758884-63758906 GGTTAGAAGAAGCATCTTTAGGG - Intergenic
1054533811 9:66209088-66209110 GGTTAGAAGAAGCATCTTTAGGG + Intergenic
1055775071 9:79759131-79759153 GGTGAGTTGGGTCATCTTTTGGG + Intergenic
1059340625 9:113595527-113595549 GGTAAGCTGAGGCATCTTAAGGG + Intronic
1060091595 9:120748034-120748056 AGTGATAGGAGGCATCTTTCCGG - Intergenic
1202798656 9_KI270719v1_random:151808-151830 GGTTAGAAGAAGCATCTTTAGGG - Intergenic
1185527112 X:788833-788855 GGAGAGATGAGGCTTCCGTATGG + Intergenic
1189802553 X:44705419-44705441 GATGAGATGGGGCATGTTCAGGG + Intergenic
1195589673 X:106610469-106610491 GGTGAGGGGAGGCATCATGAAGG + Intergenic
1195623589 X:106984401-106984423 GGTAAAATGTGGCATGTTTAAGG - Intronic
1195798276 X:108677977-108677999 GGTGAATAGAGGCATCTTTTAGG + Intronic
1197701024 X:129599758-129599780 GATGAGATGAGGCACATTCACGG + Intergenic