ID: 1003052657

View in Genome Browser
Species Human (GRCh38)
Location 6:2793759-2793781
Sequence GTAAGAAGGCGTGTTTTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003052657_1003052660 -2 Left 1003052657 6:2793759-2793781 CCGGTGAAAACACGCCTTCTTAC No data
Right 1003052660 6:2793780-2793802 ACTCATTTGGCTCCTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003052657 Original CRISPR GTAAGAAGGCGTGTTTTCAC CGG (reversed) Intergenic
No off target data available for this crispr