ID: 1003053515

View in Genome Browser
Species Human (GRCh38)
Location 6:2800011-2800033
Sequence ATACATAAGTAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003053512_1003053515 -7 Left 1003053512 6:2799995-2800017 CCTGTGTTGTTAGAACATACATA No data
Right 1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG No data
1003053511_1003053515 0 Left 1003053511 6:2799988-2800010 CCTTTTTCCTGTGTTGTTAGAAC No data
Right 1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003053515 Original CRISPR ATACATAAGTAAATGGAGCT GGG Intergenic
No off target data available for this crispr