ID: 1003056690

View in Genome Browser
Species Human (GRCh38)
Location 6:2827145-2827167
Sequence TTAGGTGACCGAAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003056690_1003056696 18 Left 1003056690 6:2827145-2827167 CCCACTTCCTTTCGGTCACCTAA No data
Right 1003056696 6:2827186-2827208 TTAAAAACTCGGAAGATATTTGG No data
1003056690_1003056695 7 Left 1003056690 6:2827145-2827167 CCCACTTCCTTTCGGTCACCTAA No data
Right 1003056695 6:2827175-2827197 TTTCTGAAATATTAAAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003056690 Original CRISPR TTAGGTGACCGAAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr