ID: 1003058328

View in Genome Browser
Species Human (GRCh38)
Location 6:2842319-2842341
Sequence CCTCAATGGTGGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003058323_1003058328 2 Left 1003058323 6:2842294-2842316 CCAAGATGACAGCTTGCTGCTGC No data
Right 1003058328 6:2842319-2842341 CCTCAATGGTGGAAAGTGGAAGG No data
1003058322_1003058328 16 Left 1003058322 6:2842280-2842302 CCTGCTCTCTGTTTCCAAGATGA No data
Right 1003058328 6:2842319-2842341 CCTCAATGGTGGAAAGTGGAAGG No data
1003058321_1003058328 23 Left 1003058321 6:2842273-2842295 CCAAACACCTGCTCTCTGTTTCC No data
Right 1003058328 6:2842319-2842341 CCTCAATGGTGGAAAGTGGAAGG No data
1003058320_1003058328 29 Left 1003058320 6:2842267-2842289 CCAGTTCCAAACACCTGCTCTCT No data
Right 1003058328 6:2842319-2842341 CCTCAATGGTGGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003058328 Original CRISPR CCTCAATGGTGGAAAGTGGA AGG Intergenic
No off target data available for this crispr