ID: 1003059526

View in Genome Browser
Species Human (GRCh38)
Location 6:2851930-2851952
Sequence ATCAGCCAACTGGGCAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003059526_1003059529 8 Left 1003059526 6:2851930-2851952 CCACATTTGCCCAGTTGGCTGAT No data
Right 1003059529 6:2851961-2851983 GTACAAAGTCTGTCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003059526 Original CRISPR ATCAGCCAACTGGGCAAATG TGG (reversed) Intergenic
No off target data available for this crispr