ID: 1003059857

View in Genome Browser
Species Human (GRCh38)
Location 6:2854382-2854404
Sequence ATTGTGCTTGGGTTTCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003059850_1003059857 29 Left 1003059850 6:2854330-2854352 CCCTCTTCTGGATAAAATTACCT No data
Right 1003059857 6:2854382-2854404 ATTGTGCTTGGGTTTCCAAATGG No data
1003059852_1003059857 9 Left 1003059852 6:2854350-2854372 CCTTTGTAATTTCTTTTTACAAC No data
Right 1003059857 6:2854382-2854404 ATTGTGCTTGGGTTTCCAAATGG No data
1003059851_1003059857 28 Left 1003059851 6:2854331-2854353 CCTCTTCTGGATAAAATTACCTT No data
Right 1003059857 6:2854382-2854404 ATTGTGCTTGGGTTTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003059857 Original CRISPR ATTGTGCTTGGGTTTCCAAA TGG Intergenic