ID: 1003062821

View in Genome Browser
Species Human (GRCh38)
Location 6:2876069-2876091
Sequence CGGGGGAAACCGAGCGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003062821_1003062839 19 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062839 6:2876111-2876133 GGTGCGCGTGGGCGGGCGGCCGG No data
1003062821_1003062841 21 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062841 6:2876113-2876135 TGCGCGTGGGCGGGCGGCCGGGG No data
1003062821_1003062832 -3 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG No data
1003062821_1003062833 -2 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062833 6:2876090-2876112 CGCGGGGCAGCGCGGGCGCGGGG No data
1003062821_1003062835 8 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062835 6:2876100-2876122 CGCGGGCGCGGGGTGCGCGTGGG No data
1003062821_1003062838 15 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062838 6:2876107-2876129 GCGGGGTGCGCGTGGGCGGGCGG No data
1003062821_1003062834 7 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062834 6:2876099-2876121 GCGCGGGCGCGGGGTGCGCGTGG No data
1003062821_1003062837 12 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062837 6:2876104-2876126 GGCGCGGGGTGCGCGTGGGCGGG No data
1003062821_1003062830 -4 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062830 6:2876088-2876110 CCCGCGGGGCAGCGCGGGCGCGG No data
1003062821_1003062836 11 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062836 6:2876103-2876125 GGGCGCGGGGTGCGCGTGGGCGG No data
1003062821_1003062843 25 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062843 6:2876117-2876139 CGTGGGCGGGCGGCCGGGGTGGG No data
1003062821_1003062845 30 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062845 6:2876122-2876144 GCGGGCGGCCGGGGTGGGCAGGG No data
1003062821_1003062844 29 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062844 6:2876121-2876143 GGCGGGCGGCCGGGGTGGGCAGG No data
1003062821_1003062825 -10 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062825 6:2876082-2876104 GTTTCCCCCGCGGGGCAGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 62
1003062821_1003062842 24 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062842 6:2876116-2876138 GCGTGGGCGGGCGGCCGGGGTGG No data
1003062821_1003062840 20 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062840 6:2876112-2876134 GTGCGCGTGGGCGGGCGGCCGGG No data
1003062821_1003062826 -9 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062826 6:2876083-2876105 TTTCCCCCGCGGGGCAGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003062821 Original CRISPR CGGGGGAAACCGAGCGCTGC AGG (reversed) Intergenic