ID: 1003062825

View in Genome Browser
Species Human (GRCh38)
Location 6:2876082-2876104
Sequence GTTTCCCCCGCGGGGCAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003062821_1003062825 -10 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062825 6:2876082-2876104 GTTTCCCCCGCGGGGCAGCGCGG 0: 1
1: 0
2: 1
3: 8
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003062825 Original CRISPR GTTTCCCCCGCGGGGCAGCG CGG Intergenic