ID: 1003062833

View in Genome Browser
Species Human (GRCh38)
Location 6:2876090-2876112
Sequence CGCGGGGCAGCGCGGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003062821_1003062833 -2 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062833 6:2876090-2876112 CGCGGGGCAGCGCGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003062833 Original CRISPR CGCGGGGCAGCGCGGGCGCG GGG Intergenic