ID: 1003062834

View in Genome Browser
Species Human (GRCh38)
Location 6:2876099-2876121
Sequence GCGCGGGCGCGGGGTGCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003062821_1003062834 7 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062834 6:2876099-2876121 GCGCGGGCGCGGGGTGCGCGTGG No data
1003062827_1003062834 -10 Left 1003062827 6:2876086-2876108 CCCCCGCGGGGCAGCGCGGGCGC No data
Right 1003062834 6:2876099-2876121 GCGCGGGCGCGGGGTGCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003062834 Original CRISPR GCGCGGGCGCGGGGTGCGCG TGG Intergenic