ID: 1003062834 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:2876099-2876121 |
Sequence | GCGCGGGCGCGGGGTGCGCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1003062821_1003062834 | 7 | Left | 1003062821 | 6:2876069-2876091 | CCTGCAGCGCTCGGTTTCCCCCG | No data | ||
Right | 1003062834 | 6:2876099-2876121 | GCGCGGGCGCGGGGTGCGCGTGG | No data | ||||
1003062827_1003062834 | -10 | Left | 1003062827 | 6:2876086-2876108 | CCCCCGCGGGGCAGCGCGGGCGC | No data | ||
Right | 1003062834 | 6:2876099-2876121 | GCGCGGGCGCGGGGTGCGCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1003062834 | Original CRISPR | GCGCGGGCGCGGGGTGCGCG TGG | Intergenic | ||