ID: 1003062835

View in Genome Browser
Species Human (GRCh38)
Location 6:2876100-2876122
Sequence CGCGGGCGCGGGGTGCGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003062821_1003062835 8 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062835 6:2876100-2876122 CGCGGGCGCGGGGTGCGCGTGGG No data
1003062828_1003062835 -10 Left 1003062828 6:2876087-2876109 CCCCGCGGGGCAGCGCGGGCGCG No data
Right 1003062835 6:2876100-2876122 CGCGGGCGCGGGGTGCGCGTGGG No data
1003062827_1003062835 -9 Left 1003062827 6:2876086-2876108 CCCCCGCGGGGCAGCGCGGGCGC No data
Right 1003062835 6:2876100-2876122 CGCGGGCGCGGGGTGCGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003062835 Original CRISPR CGCGGGCGCGGGGTGCGCGT GGG Intergenic