ID: 1003062840

View in Genome Browser
Species Human (GRCh38)
Location 6:2876112-2876134
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003062831_1003062840 0 Left 1003062831 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG No data
Right 1003062840 6:2876112-2876134 GTGCGCGTGGGCGGGCGGCCGGG No data
1003062827_1003062840 3 Left 1003062827 6:2876086-2876108 CCCCCGCGGGGCAGCGCGGGCGC No data
Right 1003062840 6:2876112-2876134 GTGCGCGTGGGCGGGCGGCCGGG No data
1003062829_1003062840 1 Left 1003062829 6:2876088-2876110 CCCGCGGGGCAGCGCGGGCGCGG No data
Right 1003062840 6:2876112-2876134 GTGCGCGTGGGCGGGCGGCCGGG No data
1003062821_1003062840 20 Left 1003062821 6:2876069-2876091 CCTGCAGCGCTCGGTTTCCCCCG No data
Right 1003062840 6:2876112-2876134 GTGCGCGTGGGCGGGCGGCCGGG No data
1003062828_1003062840 2 Left 1003062828 6:2876087-2876109 CCCCGCGGGGCAGCGCGGGCGCG No data
Right 1003062840 6:2876112-2876134 GTGCGCGTGGGCGGGCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003062840 Original CRISPR GTGCGCGTGGGCGGGCGGCC GGG Intergenic