ID: 1003064864

View in Genome Browser
Species Human (GRCh38)
Location 6:2895257-2895279
Sequence GTGGGTGAGGAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4606
Summary {0: 1, 1: 1, 2: 48, 3: 491, 4: 4065}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003064845_1003064864 26 Left 1003064845 6:2895208-2895230 CCATCTGAAACACCCGTGAAATT 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG 0: 1
1: 1
2: 48
3: 491
4: 4065
1003064851_1003064864 14 Left 1003064851 6:2895220-2895242 CCCGTGAAATTAGAGGGGGCGGA 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG 0: 1
1: 1
2: 48
3: 491
4: 4065
1003064852_1003064864 13 Left 1003064852 6:2895221-2895243 CCGTGAAATTAGAGGGGGCGGAG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG 0: 1
1: 1
2: 48
3: 491
4: 4065

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003064864 Original CRISPR GTGGGTGAGGAGAGGGAGGA GGG Intronic
Too many off-targets to display for this crispr