ID: 1003065963

View in Genome Browser
Species Human (GRCh38)
Location 6:2903550-2903572
Sequence CTGAAGAGGCCCTGGCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003065963_1003065978 27 Left 1003065963 6:2903550-2903572 CCCCGGCGCCAGGGCCTCTTCAG No data
Right 1003065978 6:2903600-2903622 AGAAGTAGGTTGGGAGCCTGCGG No data
1003065963_1003065974 17 Left 1003065963 6:2903550-2903572 CCCCGGCGCCAGGGCCTCTTCAG No data
Right 1003065974 6:2903590-2903612 GACAGCCCAGAGAAGTAGGTTGG No data
1003065963_1003065975 18 Left 1003065963 6:2903550-2903572 CCCCGGCGCCAGGGCCTCTTCAG No data
Right 1003065975 6:2903591-2903613 ACAGCCCAGAGAAGTAGGTTGGG No data
1003065963_1003065972 13 Left 1003065963 6:2903550-2903572 CCCCGGCGCCAGGGCCTCTTCAG No data
Right 1003065972 6:2903586-2903608 ACCTGACAGCCCAGAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003065963 Original CRISPR CTGAAGAGGCCCTGGCGCCG GGG (reversed) Intergenic
No off target data available for this crispr