ID: 1003067751

View in Genome Browser
Species Human (GRCh38)
Location 6:2918079-2918101
Sequence AGCACTCATGACTCTCCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003067751_1003067752 -7 Left 1003067751 6:2918079-2918101 CCGTCTGGAGAGTCATGAGTGCT No data
Right 1003067752 6:2918095-2918117 GAGTGCTTTTAAACAAATGTAGG No data
1003067751_1003067755 18 Left 1003067751 6:2918079-2918101 CCGTCTGGAGAGTCATGAGTGCT No data
Right 1003067755 6:2918120-2918142 GCAATTACTTTGGAGTTTTAGGG No data
1003067751_1003067756 29 Left 1003067751 6:2918079-2918101 CCGTCTGGAGAGTCATGAGTGCT No data
Right 1003067756 6:2918131-2918153 GGAGTTTTAGGGAAACCATATGG No data
1003067751_1003067754 17 Left 1003067751 6:2918079-2918101 CCGTCTGGAGAGTCATGAGTGCT No data
Right 1003067754 6:2918119-2918141 TGCAATTACTTTGGAGTTTTAGG No data
1003067751_1003067753 8 Left 1003067751 6:2918079-2918101 CCGTCTGGAGAGTCATGAGTGCT No data
Right 1003067753 6:2918110-2918132 AATGTAGGATGCAATTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003067751 Original CRISPR AGCACTCATGACTCTCCAGA CGG (reversed) Intergenic
No off target data available for this crispr