ID: 1003067752

View in Genome Browser
Species Human (GRCh38)
Location 6:2918095-2918117
Sequence GAGTGCTTTTAAACAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003067751_1003067752 -7 Left 1003067751 6:2918079-2918101 CCGTCTGGAGAGTCATGAGTGCT No data
Right 1003067752 6:2918095-2918117 GAGTGCTTTTAAACAAATGTAGG No data
1003067749_1003067752 21 Left 1003067749 6:2918051-2918073 CCGGTTTCAGGCATCTGAACTCT No data
Right 1003067752 6:2918095-2918117 GAGTGCTTTTAAACAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003067752 Original CRISPR GAGTGCTTTTAAACAAATGT AGG Intergenic
No off target data available for this crispr