ID: 1003067755

View in Genome Browser
Species Human (GRCh38)
Location 6:2918120-2918142
Sequence GCAATTACTTTGGAGTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003067751_1003067755 18 Left 1003067751 6:2918079-2918101 CCGTCTGGAGAGTCATGAGTGCT No data
Right 1003067755 6:2918120-2918142 GCAATTACTTTGGAGTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003067755 Original CRISPR GCAATTACTTTGGAGTTTTA GGG Intergenic
No off target data available for this crispr