ID: 1003069245

View in Genome Browser
Species Human (GRCh38)
Location 6:2931691-2931713
Sequence TGACAAATGCTGACCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003069245_1003069253 29 Left 1003069245 6:2931691-2931713 CCTGCCTGGGTCAGCATTTGTCA No data
Right 1003069253 6:2931743-2931765 TAGTAACAGCTACAGGAGGGGGG No data
1003069245_1003069252 28 Left 1003069245 6:2931691-2931713 CCTGCCTGGGTCAGCATTTGTCA No data
Right 1003069252 6:2931742-2931764 TTAGTAACAGCTACAGGAGGGGG No data
1003069245_1003069251 27 Left 1003069245 6:2931691-2931713 CCTGCCTGGGTCAGCATTTGTCA No data
Right 1003069251 6:2931741-2931763 GTTAGTAACAGCTACAGGAGGGG No data
1003069245_1003069250 26 Left 1003069245 6:2931691-2931713 CCTGCCTGGGTCAGCATTTGTCA No data
Right 1003069250 6:2931740-2931762 TGTTAGTAACAGCTACAGGAGGG No data
1003069245_1003069249 25 Left 1003069245 6:2931691-2931713 CCTGCCTGGGTCAGCATTTGTCA No data
Right 1003069249 6:2931739-2931761 TTGTTAGTAACAGCTACAGGAGG No data
1003069245_1003069248 22 Left 1003069245 6:2931691-2931713 CCTGCCTGGGTCAGCATTTGTCA No data
Right 1003069248 6:2931736-2931758 GTGTTGTTAGTAACAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003069245 Original CRISPR TGACAAATGCTGACCCAGGC AGG (reversed) Intergenic
No off target data available for this crispr