ID: 1003069710

View in Genome Browser
Species Human (GRCh38)
Location 6:2936102-2936124
Sequence TGCGCGGGAGCCCACGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003069710_1003069720 16 Left 1003069710 6:2936102-2936124 CCGCCGCCGTGGGCTCCCGCGCA No data
Right 1003069720 6:2936141-2936163 CGAGCACCGCCCCCTGCTCCAGG No data
1003069710_1003069723 24 Left 1003069710 6:2936102-2936124 CCGCCGCCGTGGGCTCCCGCGCA No data
Right 1003069723 6:2936149-2936171 GCCCCCTGCTCCAGGGCACCCGG No data
1003069710_1003069721 17 Left 1003069710 6:2936102-2936124 CCGCCGCCGTGGGCTCCCGCGCA No data
Right 1003069721 6:2936142-2936164 GAGCACCGCCCCCTGCTCCAGGG 0: 83
1: 441
2: 475
3: 359
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003069710 Original CRISPR TGCGCGGGAGCCCACGGCGG CGG (reversed) Intergenic
No off target data available for this crispr