ID: 1003074571

View in Genome Browser
Species Human (GRCh38)
Location 6:2971697-2971719
Sequence CTCGCGGCCCCTCCGGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003074571_1003074575 -10 Left 1003074571 6:2971697-2971719 CCGCCAGCCGGAGGGGCCGCGAG 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1003074575 6:2971710-2971732 GGGCCGCGAGTCCTGCCCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 172
1003074571_1003074581 14 Left 1003074571 6:2971697-2971719 CCGCCAGCCGGAGGGGCCGCGAG 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1003074581 6:2971734-2971756 CTTGACTTTGACCACAGTACAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1003074571_1003074582 15 Left 1003074571 6:2971697-2971719 CCGCCAGCCGGAGGGGCCGCGAG 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1003074582 6:2971735-2971757 TTGACTTTGACCACAGTACAGGG 0: 1
1: 0
2: 1
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003074571 Original CRISPR CTCGCGGCCCCTCCGGCTGG CGG (reversed) Intronic
900582964 1:3418414-3418436 GTCTCGGCCCCTCAGTCTGGCGG - Intronic
900602730 1:3509955-3509977 CTCGCAGCCGCCACGGCTGGAGG + Exonic
900786897 1:4655140-4655162 CTCGCGGCCCCCTCCGCCGGCGG - Exonic
904044852 1:27603101-27603123 CCCGCGGCTCCCCCGGCTCGGGG - Intronic
904177780 1:28643121-28643143 CGCGCGGCTCTTCCGGCCGGCGG + Intergenic
904607096 1:31704016-31704038 CTGCCGGCCACTCCGGGTGGGGG + Exonic
904960437 1:34328428-34328450 CTAGCTGCCTTTCCGGCTGGAGG + Intergenic
906044512 1:42817368-42817390 CGCGCGGCCGCTCCTGCGGGCGG - Intronic
907417295 1:54323381-54323403 CTCCCAGCCCCACCTGCTGGAGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912764384 1:112395953-112395975 CTCGCGCCCCTCCCGGCTCGGGG - Intergenic
915165168 1:153944344-153944366 GGAGCGGCCCCCCCGGCTGGTGG - Exonic
915586192 1:156845250-156845272 AGCTGGGCCCCTCCGGCTGGGGG - Exonic
916444497 1:164859625-164859647 CTCTTGGCCCCTCTTGCTGGGGG + Intronic
919780128 1:201216182-201216204 CTCCCGGCCCCACCGTCCGGTGG - Intronic
919831507 1:201543973-201543995 GTGGTGGCCCCTCCGGCTGGAGG - Intergenic
921060203 1:211578809-211578831 GGCGCGGCGCCGCCGGCTGGCGG - Intergenic
922950949 1:229558350-229558372 CTCGCGGCCCCGGCAGCTGCAGG - Exonic
1069438565 10:68407370-68407392 CCCGCGGACCCTGCGGCGGGCGG + Intergenic
1070319979 10:75347436-75347458 CTGCCAGCCCCTCCGGCAGGAGG - Intergenic
1072757452 10:98030480-98030502 CTCTCGGCCCCGCCGCCTAGGGG + Exonic
1075080713 10:119381760-119381782 CTCTCGGCCCCTGCACCTGGCGG - Intronic
1075522939 10:123154819-123154841 CTCTCGGCCCCTCCCTCTGGGGG + Intronic
1076916678 10:133425885-133425907 CATGCGGCTCCTCCGGCTGCGGG + Intergenic
1076936782 10:133570680-133570702 CATGCGGCTCCTCCGGCTGCGGG + Intergenic
1081872985 11:46391668-46391690 CGCGCGGCCCCGCGGGCCGGCGG + Intergenic
1083766143 11:64842476-64842498 CGTGGGGCCCCTCAGGCTGGAGG + Intronic
1083904894 11:65662982-65663004 CTCCCGGCCCCTGCGCCGGGCGG - Exonic
1085474891 11:76783475-76783497 CTCGCGGCCCCTTCGGAGGGCGG + Intronic
1090400684 11:126446717-126446739 CTCGGGGCACCTCTGGCAGGGGG - Intronic
1090699218 11:129279352-129279374 CTCGCGCCCCGTCAGGCTCGGGG + Intergenic
1091849133 12:3681071-3681093 CTTGAGGCCTCTCCTGCTGGAGG + Intronic
1097925434 12:65121609-65121631 CTCGCGGCCCCGCCCCCGGGGGG - Intergenic
1101874399 12:108589232-108589254 CTGGGGCCCCCTCCGGCTGGAGG + Intergenic
1101970624 12:109309778-109309800 CTCGCGGCCCCAGCAGGTGGAGG - Intergenic
1104724680 12:131068407-131068429 CTCCCCGCCCCTCTGTCTGGTGG - Intronic
1104802636 12:131565176-131565198 CTCCCCGCCCCTCTGTCTGGTGG + Intergenic
1112843284 13:103606370-103606392 CTCCTGGCCCCTCCAGCAGGAGG + Intergenic
1113082493 13:106534275-106534297 CCCGCGCACCCTCGGGCTGGCGG + Intronic
1113388461 13:109873095-109873117 CTGGCAGCCCCTCAGGGTGGAGG + Intergenic
1114474219 14:22982433-22982455 GACGCAGCCCCTCCCGCTGGGGG - Exonic
1116835810 14:49768243-49768265 CTCGCGGCCCCTCTGTCTGCAGG + Exonic
1118350842 14:64971847-64971869 TTGCCAGCCCCTCCGGCTGGAGG - Intronic
1118371851 14:65144302-65144324 CTCGGGGACCCACCGGCTGCAGG + Intergenic
1119176308 14:72569908-72569930 CACCCAGCCCCTCGGGCTGGTGG + Intergenic
1119753676 14:77098653-77098675 CTCCCCGCCCAGCCGGCTGGCGG - Intronic
1121411059 14:93748577-93748599 CTCTCTGCCCCCCTGGCTGGTGG + Intronic
1122744018 14:103887545-103887567 CTCCCGCCCCATCCAGCTGGAGG + Intergenic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1123048299 14:105528784-105528806 CGCGCGGCCCCCACGCCTGGCGG - Exonic
1124848142 15:33311244-33311266 CTCGCGGCCCCGCGGGTAGGTGG - Intronic
1129082431 15:73052507-73052529 CGCGCAGCCCCTCTCGCTGGAGG - Exonic
1130991310 15:88877592-88877614 CTCCCTGCCCCTCAGCCTGGGGG - Exonic
1133002470 16:2858242-2858264 CCCGCGGCCACCCCGGCTGTGGG + Intergenic
1133286946 16:4694885-4694907 TTCCAGGCCCCTCCTGCTGGAGG + Intronic
1134296029 16:12946662-12946684 CTGGCTGTCCCTCTGGCTGGAGG + Intronic
1137531733 16:49282327-49282349 CTCGCGCCCGCGCCCGCTGGGGG - Intergenic
1138037743 16:53625406-53625428 CTGGCGGCCGCCCCGTCTGGGGG + Intronic
1140810007 16:78567800-78567822 CTCGAGACCACCCCGGCTGGAGG - Intronic
1142188464 16:88706107-88706129 CTCGCGACCCCTCCCGCGGCGGG + Intronic
1142349787 16:89574845-89574867 CTCAGGGCCCCGCCGGCGGGAGG - Intergenic
1142417193 16:89949143-89949165 CTCGAGGCCCCTGCGCCGGGCGG - Intronic
1143174260 17:4947638-4947660 CTCCAGGCCCCGCCGGATGGCGG + Intronic
1143181329 17:4986249-4986271 CCCCCGGCCCCTCAGGCCGGGGG - Exonic
1148549746 17:48543422-48543444 CGGGCGGCCCCTCCGCCTCGCGG - Exonic
1148733380 17:49851244-49851266 CCCGCGGCCCCGGCGGCGGGTGG + Intergenic
1151343018 17:73484092-73484114 CTCCCCGCTCCTCCGGCTCGGGG + Intronic
1151727167 17:75891950-75891972 CCAGCTGCCCCTCCCGCTGGGGG - Intronic
1151948347 17:77331579-77331601 CTTGCGGCGCCACCTGCTGGAGG - Intronic
1152922625 17:83073528-83073550 CTCTCAGCCCCTCCAGCTGGGGG + Intergenic
1153514245 18:5890524-5890546 CTCGCCACCCCTGCGGCTGGAGG - Exonic
1159106079 18:64002904-64002926 ATCCCGGCCCCGCCGGCTTGGGG - Intronic
1160041507 18:75349812-75349834 CTCGCTGCTGCTCCTGCTGGGGG - Intergenic
1160234322 18:77074126-77074148 TTCGCAGCCCCTCAGTCTGGGGG + Intronic
1160843359 19:1156120-1156142 CTCAGGGCCCCTGCTGCTGGAGG - Intronic
1162588559 19:11576449-11576471 CTCGGGGCCTCTCAGGCTGCTGG + Exonic
926035117 2:9630510-9630532 CTCGAGGCTCCTCCCGCTGCGGG - Exonic
926357882 2:12057621-12057643 CCCACGGCCCCTCCTGCTGCCGG - Intergenic
927943327 2:27119081-27119103 CGCGCAGCCCCTCCGGCCGCGGG - Exonic
930008423 2:46915874-46915896 CGCCGGGCCCCTCCCGCTGGCGG + Intronic
930136206 2:47905967-47905989 CTCGCGGCCGCCCCGCCCGGCGG - Intergenic
938566310 2:132522090-132522112 CCTGTGGCCCCGCCGGCTGGGGG + Intronic
940751209 2:157628822-157628844 CCCACGCCCCCTGCGGCTGGCGG + Exonic
940898943 2:159108723-159108745 CTGGCTGCCCCTCTGCCTGGAGG - Intronic
946024519 2:216664019-216664041 CTCGGGGTCCCCCCGGATGGTGG - Exonic
948040977 2:234901268-234901290 CACCCAGCCCCTGCGGCTGGTGG + Intergenic
948369035 2:237475625-237475647 CTCGGGGCCCCGCCGGCTTCGGG - Intergenic
1169517957 20:6338719-6338741 CACCCGGACCCTCAGGCTGGAGG + Intergenic
1175120895 20:56715491-56715513 CTGCCGGTCCCTCCAGCTGGTGG + Intergenic
1175782860 20:61694655-61694677 CTGGCAGCCCCTCCTCCTGGAGG - Intronic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1180714120 22:17859834-17859856 CCTGCGGGCCCTCCTGCTGGTGG + Intronic
1182524281 22:30906011-30906033 GTCGCGGCGCCGGCGGCTGGAGG + Exonic
1182572329 22:31248602-31248624 CTCCCGGCACCTCTGGCTGCAGG - Exonic
1182871369 22:33650586-33650608 CTCGCGCTCCCGCTGGCTGGAGG + Exonic
1183663675 22:39235410-39235432 CTCCCCGCCCCTCTGGCTAGGGG - Intronic
1183942048 22:41301534-41301556 CTCGCGGCAGCACCCGCTGGAGG - Exonic
1184225805 22:43128327-43128349 CACGCGGCCCCTGCAGGTGGAGG + Intronic
1184229679 22:43151814-43151836 CGCGGGCCGCCTCCGGCTGGGGG + Intronic
950767756 3:15286161-15286183 CTAGTGGCCCCTCTGGCTGCCGG + Intronic
953269164 3:41423792-41423814 CTCACTGCCTCTCTGGCTGGGGG - Intronic
959357784 3:105354113-105354135 CTCGCGGGCCCTGGGGCTGAAGG + Intergenic
967885944 3:194333623-194333645 TTCGCCGCCCCACCGGGTGGCGG + Intergenic
968489621 4:883068-883090 CTCGAGCACCCTCTGGCTGGTGG + Intronic
968533900 4:1112352-1112374 CTGGCGTCCCCTGGGGCTGGAGG + Intronic
968909303 4:3469468-3469490 CTCACCCACCCTCCGGCTGGGGG - Intronic
969619026 4:8269744-8269766 CCCGCGGACCGTCAGGCTGGAGG + Exonic
977937884 4:102827263-102827285 GCCGCGGCCTCTCCTGCTGGAGG - Intronic
978443877 4:108762677-108762699 CGCGCGGCCCCTGCAGGTGGAGG + Intronic
982198460 4:152937500-152937522 TTCCCGGCCCCTCCAGTTGGAGG - Intronic
985575344 5:671135-671157 CAGGCGGCCCCTCAGGCAGGGGG - Intronic
985649814 5:1102211-1102233 CTCACTGCCTCTCTGGCTGGAGG - Intronic
985778325 5:1856947-1856969 GTGGCGGCCCCTCTGGGTGGGGG - Intergenic
986858930 5:11904157-11904179 CTCTCAGCCCGGCCGGCTGGCGG - Intergenic
990582031 5:57174326-57174348 CTCGCCGCCCCTCCGTCGGCGGG - Intronic
998377304 5:141699714-141699736 CTGGCAGCTCCTCCAGCTGGAGG + Intergenic
998406265 5:141876354-141876376 CTCGCGCCGGCTCCGGCTTGCGG - Intronic
998850490 5:146346175-146346197 CTCCCGGCGCCTCCGGATAGGGG + Intergenic
999330761 5:150672053-150672075 CGCGGCGCCCCTCCGGCTCGTGG - Intronic
1001889407 5:175326758-175326780 CTGGGGGCCCCTCCAGCTTGGGG - Intergenic
1002192086 5:177483592-177483614 CTCCAGGCCCCTCAGGCTAGGGG + Exonic
1002196555 5:177504528-177504550 CTGGCAGCCGCTCCCGCTGGCGG + Exonic
1003074571 6:2971697-2971719 CTCGCGGCCCCTCCGGCTGGCGG - Intronic
1007226980 6:40321965-40321987 CTCACTGCCCATCAGGCTGGGGG + Intergenic
1007666503 6:43516680-43516702 ATCGCCGGCCCTCCGGCTGCTGG + Intronic
1013312424 6:108908328-108908350 CCCCAGGCCCCTCCAGCTGGGGG + Intronic
1013538730 6:111087447-111087469 CCCCCCGCCCCGCCGGCTGGGGG - Intergenic
1019780825 7:2938684-2938706 CTCGCAGCTCCTCTGCCTGGCGG + Exonic
1024043743 7:45574200-45574222 CACGCGGCTCCTCCGGCGGGCGG + Intronic
1030062674 7:105635337-105635359 TTCCAGGCCCCTCGGGCTGGGGG + Intronic
1031383662 7:121119260-121119282 CTCGCTGTCTCTCAGGCTGGAGG + Intronic
1031629901 7:124033186-124033208 CTCGCGGGCCGCCCGGCTAGCGG + Intergenic
1033159230 7:138981657-138981679 CTCGCGCTCCCTCCGGAAGGCGG - Intergenic
1033165509 7:139035775-139035797 GTGGCGGCACCTCCGCCTGGAGG - Exonic
1034426556 7:151017063-151017085 CTCGCGGCCCCTCCACCCCGGGG - Exonic
1036162967 8:6406451-6406473 CTCGCCGCGCCTCTGGCTGCTGG - Intergenic
1036195281 8:6708515-6708537 GGCGCGGCCCATGCGGCTGGGGG + Exonic
1036643969 8:10600910-10600932 CCCACGGCCCCTCCTGCTGCCGG - Intergenic
1036788118 8:11701491-11701513 CTCGCTGGGCCGCCGGCTGGAGG - Intronic
1037865697 8:22440914-22440936 CTCTCGGCTCCTCCGGCTCCGGG - Intronic
1041166984 8:55101378-55101400 CTCCCGGCTTCTCCGGCGGGCGG - Intergenic
1042514083 8:69641709-69641731 CTCTCTGTCCCTCAGGCTGGAGG - Intronic
1044692642 8:94895351-94895373 CCCACGGCCGCTCCGGGTGGCGG - Intronic
1044934195 8:97277622-97277644 CGCGCAGCTCCTCCGGCTCGGGG - Exonic
1057573228 9:96219489-96219511 CTCGTGGCCCATCCTGCAGGAGG - Intergenic
1057869520 9:98707981-98708003 CCCGCGGCCCCTCCGGCCCTGGG + Intronic
1058687424 9:107490374-107490396 CTCGCGGGCCCTTCTGCTGAGGG + Intronic
1061222142 9:129258495-129258517 CTCCCGGCCCCTCCTGCTCCGGG + Intergenic
1061917299 9:133761986-133762008 CTGGGGGCCCCCCCAGCTGGCGG - Exonic
1062354805 9:136156907-136156929 CCTGCGTCCCTTCCGGCTGGCGG + Intergenic
1062362289 9:136193689-136193711 CCCGCGCCCGCTCCAGCTGGCGG - Intergenic
1062493726 9:136821874-136821896 GTGGCGGCCGCACCGGCTGGGGG - Intronic
1062524331 9:136972202-136972224 CACGGGGCCCCTGCGTCTGGGGG - Intergenic
1187507775 X:19890493-19890515 CTCACGGTCACTCAGGCTGGAGG + Intergenic
1190761347 X:53440700-53440722 CTCCCGGCCCCTGCTGCCGGCGG - Intergenic
1200164500 X:154026847-154026869 CTCCCGGCCCTGCCTGCTGGTGG - Intronic