ID: 1003078422

View in Genome Browser
Species Human (GRCh38)
Location 6:3002028-3002050
Sequence GATTCTTATTCTTAACCGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003078422 Original CRISPR GATTCTTATTCTTAACCGCT AGG Exonic
903838462 1:26221239-26221261 GGTTCATGTTCTTAACCTCTGGG - Intergenic
914929486 1:151918071-151918093 GATTTTTATTCTGATCTGCTGGG - Intergenic
1063734069 10:8732578-8732600 GGTTATTATTCTTAACTGCTAGG + Intergenic
1065942988 10:30581918-30581940 GATTCTTGTTCTACACCACTTGG + Intergenic
1068756639 10:60661983-60662005 GATTCCTATTCTTGACAGCCTGG - Intronic
1071582938 10:86790251-86790273 GATTCTGCTTCTTACCCACTAGG + Intronic
1074233234 10:111558651-111558673 GATACTTATTTTTAGCTGCTGGG + Intergenic
1078310234 11:10233508-10233530 CATTTTTTTTCTTAACCTCTTGG + Intronic
1078679687 11:13463715-13463737 GCTGCTTATTTTTAAACGCTCGG + Intergenic
1078760546 11:14247935-14247957 GATTCCTATTCTTATGCCCTTGG - Intronic
1088778256 11:113107936-113107958 GATTATTATTGTTAACTCCTAGG + Intronic
1092990375 12:13891514-13891536 GAATTTTATTCTTAACCTCATGG + Intronic
1098811763 12:75103440-75103462 GATTCTTATTCTTCACTGCCAGG + Intronic
1099958887 12:89377931-89377953 GATACTTTTTTTTAACCTCTCGG + Intergenic
1107324693 13:39229111-39229133 GAGTCTTGTTCTGAACTGCTTGG - Intergenic
1107663762 13:42667398-42667420 TTTTCTTATTCTTAACACCTGGG + Intergenic
1108817058 13:54305167-54305189 GATCCTTATTCCTATCCGCCTGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112299341 13:98216115-98216137 GAATCTTTCTCTTAACCTCTGGG + Intronic
1115208744 14:30943009-30943031 AATTCATATTCTTAACCATTAGG + Intronic
1119338152 14:73851998-73852020 GAGTCTTCTTCCTCACCGCTGGG - Exonic
1121429792 14:93878758-93878780 GATCCTCATTCTTTACTGCTGGG - Intergenic
1123184271 14:106500258-106500280 GTTTCTTATTCTTAACCTATTGG + Intergenic
1127285817 15:57532844-57532866 GATTGTTATTCATAACCACTTGG + Intronic
1127664733 15:61134569-61134591 AATTCCTATTCTCAACCCCTTGG + Intronic
1150056207 17:62019590-62019612 GTTTCTTACTCTTAATAGCTGGG - Intronic
1151011453 17:70502683-70502705 TATTCTTACTTTTAACTGCTTGG + Intergenic
1167983378 19:53295045-53295067 GATTCTTATTCCTAACGCATTGG + Intergenic
926944908 2:18177226-18177248 AATTTTTATTCTCAAACGCTGGG + Intronic
928391448 2:30913815-30913837 GAGTCTTGTTCTTAACAGCAGGG + Intronic
930523395 2:52496599-52496621 GATTTTTATTCTAAGCCACTTGG - Intergenic
933300498 2:80535524-80535546 GACTCTTATTCTCACCAGCTGGG - Intronic
938559493 2:132459032-132459054 GATTCTGATTCTACACCTCTGGG + Intronic
940065881 2:149628530-149628552 GATTTTTATTCTTAATGACTTGG - Intergenic
941087881 2:161139268-161139290 CATTCTTAATGTTAACCACTAGG - Intronic
948713731 2:239844377-239844399 TATTATTATTCTTAAAAGCTTGG + Intergenic
1173408562 20:42788891-42788913 GATCATAATTCTTAACCACTTGG - Intronic
1181389273 22:22567873-22567895 TTTTCTTTTTCTTAACCTCTGGG + Intergenic
949508205 3:4746085-4746107 GATTCATATTCTTGACCACCAGG + Intronic
952914591 3:38224168-38224190 GATTCCCATTCTTAGCCCCTTGG + Intronic
954535562 3:51356991-51357013 GGTTCTTATTCTCAACCACTTGG - Exonic
957833486 3:85553761-85553783 TAATCTTATTCTTAATCACTAGG - Intronic
964815087 3:160708725-160708747 CATTCTTTTTCTTAATCTCTTGG - Intergenic
967381058 3:188858531-188858553 GTTTTTTATTCTTAAGCACTAGG - Intronic
967928648 3:194673722-194673744 GATTCTGATTCATAAGCTCTGGG + Intergenic
970688354 4:18593678-18593700 CACTCTTATTCTGAACTGCTGGG + Intergenic
971615412 4:28783820-28783842 AATTCTTATTCTTAATATCTAGG - Intergenic
973001096 4:44951695-44951717 GATTATTACTCTTAAATGCTGGG + Intergenic
973773474 4:54226591-54226613 GATTCTAATTTTCAACCTCTTGG - Intronic
974126306 4:57700602-57700624 GCTCATTATTCTTAACTGCTAGG + Intergenic
984721445 4:182976929-182976951 CATTATTATTATTAACAGCTTGG - Intergenic
986526419 5:8683207-8683229 GTTTCTTATACTTAACCGTAGGG + Intergenic
987119947 5:14757611-14757633 GATTCTTACTCTAAAACTCTGGG + Intronic
993675186 5:90808060-90808082 TATTCTTACTCTTAATCACTTGG - Intronic
993752478 5:91688087-91688109 GACTCTTATTCTTAAGAGTTAGG + Intergenic
995039738 5:107573932-107573954 GATTTTTATTCTTTACCACTTGG + Intronic
996674814 5:126162187-126162209 GCTTCTCATTCTTTACCGTTAGG - Intergenic
997166800 5:131669216-131669238 TATTCTTATTCTTAAAAGCCTGG + Intronic
998819893 5:146048966-146048988 GGTTCTTATTGCTAACCACTGGG + Intronic
1000660325 5:163930444-163930466 AATTATTATTTTTAACCACTTGG + Intergenic
1003078422 6:3002028-3002050 GATTCTTATTCTTAACCGCTAGG + Exonic
1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG + Intergenic
1011474620 6:87739145-87739167 GTTTCTGATTCTTAGCCACTGGG + Intergenic
1013345841 6:109259860-109259882 GATTCTCATTTTTAAGTGCTTGG + Intergenic
1019777553 7:2921652-2921674 GGATCTTATTTTTAACCGCCAGG - Intronic
1021024562 7:15648755-15648777 GATTCAGATTCTGAAGCGCTAGG - Intronic
1026310335 7:69178115-69178137 GGCTCTTATTCTAAACAGCTGGG + Intergenic
1026887887 7:73965091-73965113 GGTGCTTATTCATATCCGCTGGG + Intergenic
1031370607 7:120960329-120960351 GATTCTTAGTCTAAAGCGGTGGG + Intronic
1056753262 9:89366900-89366922 GATTCTTAGTCTCAAGGGCTTGG - Intronic
1187407562 X:19017443-19017465 GTTTCTTCTTCTTAACCACTAGG + Intronic
1189054958 X:37688837-37688859 AATTATTATTCTTAACATCTTGG - Intronic
1190784603 X:53632889-53632911 GATTCTTATTCATTACTGCTTGG - Intronic
1195801694 X:108719224-108719246 TTTTCTTATTTTTAACCACTAGG - Intergenic