ID: 1003079623

View in Genome Browser
Species Human (GRCh38)
Location 6:3010744-3010766
Sequence GTTCAGCAGCACCACACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 8, 1: 25, 2: 30, 3: 63, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003079621_1003079623 -7 Left 1003079621 6:3010728-3010750 CCAAACCAGAGTGGCTGTTCAGC 0: 1
1: 23
2: 75
3: 70
4: 161
Right 1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG 0: 8
1: 25
2: 30
3: 63
4: 258
1003079619_1003079623 5 Left 1003079619 6:3010716-3010738 CCAAAGGAGATGCCAAACCAGAG 0: 1
1: 28
2: 41
3: 72
4: 245
Right 1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG 0: 8
1: 25
2: 30
3: 63
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003079623 Original CRISPR GTTCAGCAGCACCACACTGT AGG Intronic