ID: 1003080283

View in Genome Browser
Species Human (GRCh38)
Location 6:3016015-3016037
Sequence CAGGCACATGATGCTCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003080283_1003080294 23 Left 1003080283 6:3016015-3016037 CCCCCTTGAGCATCATGTGCCTG 0: 1
1: 1
2: 1
3: 12
4: 156
Right 1003080294 6:3016061-3016083 CCCACGTGGCAGGATGAGGAGGG 0: 1
1: 0
2: 3
3: 30
4: 538
1003080283_1003080291 19 Left 1003080283 6:3016015-3016037 CCCCCTTGAGCATCATGTGCCTG 0: 1
1: 1
2: 1
3: 12
4: 156
Right 1003080291 6:3016057-3016079 GACACCCACGTGGCAGGATGAGG No data
1003080283_1003080290 13 Left 1003080283 6:3016015-3016037 CCCCCTTGAGCATCATGTGCCTG 0: 1
1: 1
2: 1
3: 12
4: 156
Right 1003080290 6:3016051-3016073 CCATGCGACACCCACGTGGCAGG No data
1003080283_1003080296 28 Left 1003080283 6:3016015-3016037 CCCCCTTGAGCATCATGTGCCTG 0: 1
1: 1
2: 1
3: 12
4: 156
Right 1003080296 6:3016066-3016088 GTGGCAGGATGAGGAGGGCATGG No data
1003080283_1003080288 9 Left 1003080283 6:3016015-3016037 CCCCCTTGAGCATCATGTGCCTG 0: 1
1: 1
2: 1
3: 12
4: 156
Right 1003080288 6:3016047-3016069 AAGACCATGCGACACCCACGTGG No data
1003080283_1003080292 22 Left 1003080283 6:3016015-3016037 CCCCCTTGAGCATCATGTGCCTG 0: 1
1: 1
2: 1
3: 12
4: 156
Right 1003080292 6:3016060-3016082 ACCCACGTGGCAGGATGAGGAGG 0: 1
1: 0
2: 2
3: 53
4: 1541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003080283 Original CRISPR CAGGCACATGATGCTCAAGG GGG (reversed) Intronic
900186120 1:1334035-1334057 CTGGCACATGCTGCCCACGGAGG + Exonic
901971741 1:12913818-12913840 CAGACACTTGATGCTGAGGGAGG - Intronic
902013427 1:13287922-13287944 CAGACACTTGATGCTGAGGGAGG + Intergenic
903340744 1:22652899-22652921 CCGCCACATGATGCTCACTGAGG + Intronic
904323286 1:29710494-29710516 CAGGAAGAACATGCTCAAGGAGG + Intergenic
904605635 1:31696262-31696284 CAGGCCCTTGATGCCCCAGGAGG - Intronic
905273561 1:36802553-36802575 CCAGCACATGTTTCTCAAGGTGG + Intronic
906240646 1:44240130-44240152 TAGGCCCATGTAGCTCAAGGAGG - Intronic
907263948 1:53243626-53243648 CAGGAACAAAAGGCTCAAGGGGG - Intergenic
923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG + Intronic
1064219790 10:13431004-13431026 CACAAACATGATGCTCCAGGAGG - Intergenic
1067020872 10:42796471-42796493 CAGGCTAATGATGCCAAAGGAGG + Exonic
1069012592 10:63391058-63391080 CAGTCACATTATTCTCAAAGAGG - Intronic
1069775764 10:70926292-70926314 CAGGCACCTTGTGCTCAGGGTGG - Intergenic
1072893053 10:99342128-99342150 CAGGCACATGATTCTCAACATGG - Intronic
1075817127 10:125273055-125273077 CAGGCCCATAATGCTCAGGAGGG + Intergenic
1079916426 11:26373396-26373418 CAGGCACATTCTTCACAAGGTGG - Intronic
1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG + Intergenic
1089494706 11:118902275-118902297 CAGGCACTTCATGCTCCAGCGGG + Exonic
1091004722 11:131942603-131942625 CAGGAAGATGATGCAGAAGGGGG + Intronic
1091170756 11:133517904-133517926 CAGGCACAGAATGGGCAAGGAGG + Intronic
1101379412 12:104201539-104201561 CAGGAGCATGATGCTGTAGGAGG - Intergenic
1103873637 12:124110026-124110048 CAGGGACATGAGGCTGGAGGTGG + Intronic
1104376077 12:128266801-128266823 CAGGGACCCGACGCTCAAGGCGG - Intergenic
1105945912 13:25189265-25189287 CTGGCACAGGAGGGTCAAGGTGG + Intergenic
1111174144 13:84571407-84571429 CAGGCACGTTCTCCTCAAGGTGG + Intergenic
1114337143 14:21701798-21701820 CATGCAAATGATGCTAAAGCAGG + Intergenic
1119029423 14:71180032-71180054 CATGAAAATGATGCTGAAGGTGG + Intergenic
1119666952 14:76491646-76491668 CAGGTACAAGAAGCTCAAGGTGG + Exonic
1121684314 14:95821760-95821782 CAGGCACATTCTTCACAAGGTGG - Intergenic
1124360179 15:29030958-29030980 AAGGTACATGATGCTCTTGGTGG + Intronic
1125596556 15:40890990-40891012 CAGTGACATAATGGTCAAGGAGG - Intergenic
1128267316 15:66278258-66278280 AAGGGACTTGATGCTCAAAGGGG + Intergenic
1128303174 15:66580127-66580149 CAGGCACAAAATACTCAGGGAGG + Intergenic
1129510298 15:76116574-76116596 CACACTCATGATGGTCAAGGTGG - Intronic
1132622368 16:873917-873939 CAGGGTCATGGTGCTCAGGGAGG + Intronic
1133620446 16:7521120-7521142 CAAGGAGATGATGCTTAAGGTGG + Intronic
1135885202 16:26299789-26299811 CAGACACATGAAGCTCTATGAGG - Intergenic
1139477935 16:67212205-67212227 CAGGCACGTGGTACTCAAAGAGG + Intronic
1140057385 16:71537190-71537212 CAGCCACGTGGTGCTCAAGGAGG + Exonic
1140506909 16:75479303-75479325 CAGCCACGTGGTGCTCAAGGAGG - Exonic
1140514080 16:75529793-75529815 CAGCCACGTGGTGCTCAAGGAGG - Exonic
1140846452 16:78893216-78893238 CAGGCATAAGATGGTCAAGAGGG - Intronic
1141193697 16:81843240-81843262 TGGGCAAATGATGGTCAAGGAGG - Intronic
1141725836 16:85787787-85787809 CAGGCACAGGATCCTGAGGGAGG - Intronic
1141897881 16:86970259-86970281 CAGGCACGTGATGATGATGGAGG + Intergenic
1144264486 17:13554986-13555008 CAGGCACGTGCTGCTGAATGAGG - Intronic
1146904698 17:36610613-36610635 CAGGGACAGGGAGCTCAAGGGGG - Intergenic
1147056437 17:37838821-37838843 CAGGCACATGGAGCTCAGCGTGG - Intergenic
1147712406 17:42478568-42478590 CAGTCACAGGATCCTCCAGGGGG - Exonic
1148782420 17:50129562-50129584 CAGGCCCATGGTGCTCGAGGCGG + Exonic
1149369301 17:55977538-55977560 CAGGCACCTTATTCACAAGGTGG + Intergenic
1152715721 17:81899635-81899657 CAGGCTCATCATGCTCAGTGGGG - Intronic
1157646111 18:49273781-49273803 CAGTCACATGTTGCTTAATGTGG - Intronic
1158244352 18:55413961-55413983 AATGCACATTATTCTCAAGGAGG + Intronic
1158520594 18:58169109-58169131 CAGGCACAGGCCTCTCAAGGGGG - Intronic
1161261210 19:3338826-3338848 CAGGCAGCTGGTGCCCAAGGTGG - Intergenic
1166431383 19:42730624-42730646 CAGGCAGTGGAGGCTCAAGGTGG + Intronic
1166434504 19:42755834-42755856 CAGGCAGTGGAGGCTCAAGGTGG + Intronic
1166447357 19:42869602-42869624 CAGGCAGTGGAGGCTCAAGGTGG + Intronic
1166454270 19:42927284-42927306 CAGGCAGTGGAGGCTCAAGGTGG + Intronic
1166490936 19:43259703-43259725 CAGGCAGTGGAGGCTCAAGGTGG + Intronic
1166745818 19:45141423-45141445 CGCCCACATGATGCGCAAGGTGG + Exonic
1167006401 19:46778881-46778903 CAGGAACATGATGCCCACAGGGG + Exonic
1167034732 19:46988399-46988421 CAGGCACATGATATACAAGTCGG + Intronic
1167708812 19:51098124-51098146 CAGGAATCTGATGCTCAAGGAGG + Exonic
1167781629 19:51602159-51602181 CAGGAATCTGGTGCTCAAGGAGG - Intergenic
925430003 2:3783281-3783303 CATGCACAGGATGCTCTTGGAGG - Intronic
925682144 2:6433831-6433853 TATGCACATGATTCTCCAGGAGG - Intergenic
926419912 2:12686107-12686129 CAGGCACCATATGCTCAAGGAGG - Intergenic
927437050 2:23075706-23075728 CCAGCTCATGATGCTCAGGGTGG - Intergenic
929268662 2:39947680-39947702 CAGGCATATGACGCACAATGAGG - Intergenic
930879104 2:56251739-56251761 AAGCCCCATGATGCTCAAGAAGG - Intronic
932107470 2:68959084-68959106 AAAGCAGATGATGCTCATGGTGG + Intergenic
932721290 2:74140578-74140600 GAGGCACATGTTGCTATAGGGGG + Intronic
940867186 2:158829140-158829162 CAGGCACAGGCTGCTAGAGGAGG + Intronic
1169947919 20:11009335-11009357 CAGGCAAATGAGGCTCAGCGAGG + Intergenic
1172203107 20:33140548-33140570 CCGGTTCATGATGGTCAAGGAGG + Intergenic
1172937255 20:38629193-38629215 CAGGCCCATGGGGCTCAAGATGG + Intronic
1174053114 20:47781053-47781075 CAGCCAGATGATTCTCATGGTGG + Intronic
1175761728 20:61565983-61566005 CAGGCACTTGATGGGCAACGGGG - Intronic
1177770252 21:25506015-25506037 CATGAATATGATGCTCAGGGGGG - Intergenic
1181467909 22:23120165-23120187 CAGGAACAGGAGGCTCAAAGAGG + Intronic
1184067543 22:42129106-42129128 CAGGCCCAAGTTGCGCAAGGTGG + Exonic
1184070274 22:42142801-42142823 CAGGCCCAAGTTGCGCAAGGTGG + Intergenic
1184072015 22:42152420-42152442 CAGGCCCAAGTTGCGCAAGGTGG + Intergenic
949271124 3:2218056-2218078 CAGGCACGTGAAGATCAAGGGGG + Intronic
950026999 3:9826988-9827010 CATGCACATGATGCCTACGGGGG - Exonic
950765025 3:15267160-15267182 CAGGCCCGTGAGGCTCTAGGAGG + Intronic
951001426 3:17564433-17564455 TAGGCCCATGAAGCTTAAGGGGG - Intronic
952541516 3:34372463-34372485 CAGGCACATCATTCTCAAGGTGG - Intergenic
953349296 3:42202627-42202649 CAGGGACATGATGCTCTCAGTGG - Exonic
954745813 3:52787031-52787053 CATGCCCCTGATGCTCATGGAGG - Exonic
955139673 3:56256824-56256846 CAGGCACCTTATTCACAAGGCGG - Intronic
956392631 3:68789665-68789687 CCTACACATGATGCTCAAGAGGG + Intronic
962912960 3:139871709-139871731 CAGGCACATGATTCCCTATGGGG + Intergenic
965288352 3:166845062-166845084 CAGACACATTCTGCTCAAGTGGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
968566595 4:1316692-1316714 GAGGCCCATGATGCCCCAGGTGG - Intronic
972094870 4:35335585-35335607 CAGGCACCTTATTCACAAGGAGG + Intergenic
972331556 4:38068834-38068856 CTTGGACATGCTGCTCAAGGTGG + Intronic
975333316 4:73144813-73144835 CAGGAACATGAATCTGAAGGTGG - Exonic
980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG + Intergenic
981739410 4:147986273-147986295 GAGACACATGAAGCTCATGGAGG + Intronic
986298580 5:6460194-6460216 GAGGCATCTGATGCTCAGGGAGG - Intronic
992067806 5:73123535-73123557 CTGCCCCATGGTGCTCAAGGTGG + Exonic
992467588 5:77022447-77022469 GATGGACATTATGCTCAAGGTGG - Intergenic
995084901 5:108097201-108097223 CAGGCACATTCTTCACAAGGCGG - Intronic
995439139 5:112170794-112170816 CAGGCACATGGAGCACATGGTGG - Intronic
996096976 5:119409293-119409315 CAGGCACATGGTACTAAATGAGG - Intergenic
997503604 5:134398111-134398133 AAGGCAAATGAGGCTGAAGGGGG + Intergenic
998113367 5:139518687-139518709 CAGGCAATTGAGGCTCAAGTGGG - Intergenic
998244209 5:140482577-140482599 CAGGAACATGAATCTGAAGGTGG + Exonic
999538608 5:152547310-152547332 CAGTCACAAGATGCCCAAAGGGG + Intergenic
1001887568 5:175309218-175309240 CAGGAAAATAATGCTCATGGGGG + Intergenic
1002125126 5:177037371-177037393 CAGTCACTTGAAGCTCAAGGGGG - Intronic
1003080283 6:3016015-3016037 CAGGCACATGATGCTCAAGGGGG - Intronic
1004125844 6:12872765-12872787 CAGGTACATCCTCCTCAAGGGGG + Intronic
1008588602 6:52970840-52970862 CAGGGACATGATGTCCAAGTTGG + Intergenic
1009377797 6:62993560-62993582 CAGGCACCTTCTGTTCAAGGTGG + Intergenic
1011457421 6:87566969-87566991 CAGGCGCATGTTGCCCAAGCTGG + Intronic
1013571379 6:111429832-111429854 CAAGCACAAGAAGCTCAAGTCGG + Intronic
1016653641 6:146492675-146492697 CAGGCATATGATGTACAATGAGG - Intergenic
1017841640 6:158227176-158227198 GAGGAACATGATGGCCAAGGAGG + Intergenic
1018344945 6:162890848-162890870 CAGAGACTTGAAGCTCAAGGGGG - Intronic
1018692392 6:166358026-166358048 CAGGCACCTTCTTCTCAAGGTGG + Intergenic
1021802008 7:24316646-24316668 CAGGCTCATGCTGCCCAGGGTGG - Intergenic
1022184944 7:27958226-27958248 TATGCACTTGATGCTCAGGGTGG + Intronic
1022686005 7:32597096-32597118 CAGGCACATGATGCTCGAGGGGG - Intergenic
1023455490 7:40334199-40334221 CATGCACACGATGTTCATGGCGG - Intronic
1023840813 7:44096541-44096563 CAGGCACAGACTGCACAAGGAGG - Intergenic
1026215924 7:68348893-68348915 CGTGCACATGACGCTCAAGTGGG - Intergenic
1026650313 7:72210575-72210597 CAGGCACCTTATTCACAAGGAGG + Intronic
1027219947 7:76207502-76207524 CAGGAACATGCTGCTGGAGGAGG + Intronic
1027244873 7:76359728-76359750 CAGGCCCAAGAGCCTCAAGGTGG - Intergenic
1027578996 7:79969145-79969167 CAGGCACCTGCTTCACAAGGTGG - Intergenic
1030746655 7:113173733-113173755 CAGGCACCTGCTTCACAAGGTGG - Intergenic
1036179663 8:6573352-6573374 CAGGCTCATGATGTTAAAGAGGG + Intronic
1039394660 8:37215014-37215036 CAGGCAGGTGGTGCTCAGGGTGG + Intergenic
1040900024 8:52409226-52409248 CTGGCGCAAGATGCGCAAGGAGG - Intronic
1041243415 8:55868930-55868952 CAGGCACATGAATGTAAAGGTGG + Intergenic
1042203771 8:66307604-66307626 CAGGCAGATGATGTTCCAGAGGG - Intergenic
1042367105 8:67950227-67950249 CAGACACATATTTCTCAAGGTGG - Intergenic
1043389053 8:79773638-79773660 CAGGCACAAGAGGCTCAGGAAGG - Intergenic
1043625232 8:82248878-82248900 CAGGCACCTGCTTCACAAGGTGG - Intergenic
1047651697 8:126929863-126929885 AAGGCACGTAATCCTCAAGGAGG + Intergenic
1048198080 8:132349164-132349186 CAGGTCCCTGATGCTCAGGGAGG + Intronic
1048594657 8:135853605-135853627 CCCGCACATTATGCTCATGGAGG - Intergenic
1049288855 8:141791132-141791154 CTGGGGCATGAGGCTCAAGGAGG + Intergenic
1049688118 8:143947130-143947152 CAGCCACAGGGTGCTCTAGGTGG - Intronic
1049794340 8:144489581-144489603 CAGCCACATGAAGCTCTGGGAGG - Intronic
1050890416 9:10818407-10818429 CAGGCACATTTTTCACAAGGTGG + Intergenic
1055120494 9:72655177-72655199 CAGGCACCTGCTTCACAAGGTGG - Intronic
1056187084 9:84145923-84145945 CAAGCACATTATACTGAAGGAGG + Intergenic
1056827011 9:89883546-89883568 CAGGCCCCTGTTGCTCACGGGGG + Intergenic
1056909169 9:90682515-90682537 CAGGCAGATGGTGGTCAAGGCGG + Intergenic
1057044959 9:91878567-91878589 CAGGCACTGGATGTGCAAGGGGG - Intronic
1060404258 9:123365444-123365466 CAGGGCCATGATGCCCTAGGCGG - Intronic
1060584925 9:124779926-124779948 CAGGAACAGGAAGCCCAAGGAGG - Intronic
1060940632 9:127541131-127541153 CAGGCACATGATGGAGATGGTGG - Intronic
1061020590 9:128011893-128011915 CTGCCACATGATGCTGAAGAAGG - Intergenic
1061071090 9:128311154-128311176 CAGGCACCTGGTGATGAAGGAGG - Intronic
1061444605 9:130630867-130630889 CAGGCACAAGCAGCACAAGGTGG - Intronic
1061487867 9:130929400-130929422 CAAGCCCATGAAGCTCAGGGAGG - Intronic
1062565101 9:137160833-137160855 CAGGCAGACGATGCTGACGGTGG + Intronic
1196129341 X:112137455-112137477 CAGGCACATCCTTCACAAGGTGG + Intergenic
1197134966 X:123050351-123050373 CAGGCACATTCTTCACAAGGTGG + Intergenic
1198297385 X:135301094-135301116 CAGGCACCTTATTCACAAGGTGG + Intronic
1198952171 X:142083579-142083601 CAGGCACCTTCTTCTCAAGGTGG + Intergenic
1200017642 X:153178989-153179011 CATGCTCAGGATTCTCAAGGAGG + Intergenic
1200884145 Y:8252275-8252297 CAGAAACAAGGTGCTCAAGGTGG + Intergenic