ID: 1003081711

View in Genome Browser
Species Human (GRCh38)
Location 6:3026583-3026605
Sequence TGACAGGACTGAGGACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081711_1003081723 28 Left 1003081711 6:3026583-3026605 CCAGTGTGTCCTCAGTCCTGTCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081711_1003081724 29 Left 1003081711 6:3026583-3026605 CCAGTGTGTCCTCAGTCCTGTCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1003081724 6:3026635-3026657 AGGAGCTTGAAATCCTGTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 198
1003081711_1003081717 9 Left 1003081711 6:3026583-3026605 CCAGTGTGTCCTCAGTCCTGTCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1003081717 6:3026615-3026637 TTCCCCACTAGAATCCCAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 149
1003081711_1003081715 6 Left 1003081711 6:3026583-3026605 CCAGTGTGTCCTCAGTCCTGTCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081711 Original CRISPR TGACAGGACTGAGGACACAC TGG (reversed) Intergenic