ID: 1003081714

View in Genome Browser
Species Human (GRCh38)
Location 6:3026599-3026621
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081714_1003081715 -10 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1003081714_1003081723 12 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081714_1003081717 -7 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081717 6:3026615-3026637 TTCCCCACTAGAATCCCAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 149
1003081714_1003081724 13 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081724 6:3026635-3026657 AGGAGCTTGAAATCCTGTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 198
1003081714_1003081725 23 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081714_1003081727 29 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081727 6:3026651-3026673 GTCTGGGATCCTGACGGCCCAGG 0: 1
1: 0
2: 3
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081714 Original CRISPR TGGGGAAGGTTTCTCCTGAC AGG (reversed) Intergenic