ID: 1003081715

View in Genome Browser
Species Human (GRCh38)
Location 6:3026612-3026634
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081714_1003081715 -10 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1003081710_1003081715 25 Left 1003081710 6:3026564-3026586 CCAGCTGATACGCAAGGTGCCAG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1003081713_1003081715 -3 Left 1003081713 6:3026592-3026614 CCTCAGTCCTGTCAGGAGAAACC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1003081711_1003081715 6 Left 1003081711 6:3026583-3026605 CCAGTGTGTCCTCAGTCCTGTCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1003081708_1003081715 27 Left 1003081708 6:3026562-3026584 CCCCAGCTGATACGCAAGGTGCC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1003081709_1003081715 26 Left 1003081709 6:3026563-3026585 CCCAGCTGATACGCAAGGTGCCA 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1003081715 6:3026612-3026634 ACCTTCCCCACTAGAATCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081715 Original CRISPR ACCTTCCCCACTAGAATCCC AGG Intergenic