ID: 1003081716

View in Genome Browser
Species Human (GRCh38)
Location 6:3026613-3026635
Sequence TCCTGGGATTCTAGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081716_1003081727 15 Left 1003081716 6:3026613-3026635 CCTTCCCCACTAGAATCCCAGGA 0: 1
1: 0
2: 3
3: 17
4: 273
Right 1003081727 6:3026651-3026673 GTCTGGGATCCTGACGGCCCAGG 0: 1
1: 0
2: 3
3: 9
4: 139
1003081716_1003081725 9 Left 1003081716 6:3026613-3026635 CCTTCCCCACTAGAATCCCAGGA 0: 1
1: 0
2: 3
3: 17
4: 273
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081716_1003081723 -2 Left 1003081716 6:3026613-3026635 CCTTCCCCACTAGAATCCCAGGA 0: 1
1: 0
2: 3
3: 17
4: 273
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081716_1003081724 -1 Left 1003081716 6:3026613-3026635 CCTTCCCCACTAGAATCCCAGGA 0: 1
1: 0
2: 3
3: 17
4: 273
Right 1003081724 6:3026635-3026657 AGGAGCTTGAAATCCTGTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081716 Original CRISPR TCCTGGGATTCTAGTGGGGA AGG (reversed) Intergenic