ID: 1003081718

View in Genome Browser
Species Human (GRCh38)
Location 6:3026617-3026639
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081718_1003081732 29 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081732 6:3026669-3026691 CCAGGTGCTGACCCTGCCTCGGG 0: 1
1: 1
2: 4
3: 34
4: 428
1003081718_1003081727 11 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081727 6:3026651-3026673 GTCTGGGATCCTGACGGCCCAGG 0: 1
1: 0
2: 3
3: 9
4: 139
1003081718_1003081723 -6 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081718_1003081725 5 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081718_1003081724 -5 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081724 6:3026635-3026657 AGGAGCTTGAAATCCTGTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 198
1003081718_1003081730 28 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081718 Original CRISPR CTCCTCCTGGGATTCTAGTG GGG (reversed) Intergenic