ID: 1003081721

View in Genome Browser
Species Human (GRCh38)
Location 6:3026629-3026651
Sequence CAGGATTTCAAGCTCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3438
Summary {0: 1, 1: 0, 2: 4, 3: 116, 4: 3317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081721_1003081730 16 Left 1003081721 6:3026629-3026651 CCCAGGAGGAGCTTGAAATCCTG 0: 1
1: 0
2: 4
3: 116
4: 3317
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081721_1003081732 17 Left 1003081721 6:3026629-3026651 CCCAGGAGGAGCTTGAAATCCTG 0: 1
1: 0
2: 4
3: 116
4: 3317
Right 1003081732 6:3026669-3026691 CCAGGTGCTGACCCTGCCTCGGG 0: 1
1: 1
2: 4
3: 34
4: 428
1003081721_1003081725 -7 Left 1003081721 6:3026629-3026651 CCCAGGAGGAGCTTGAAATCCTG 0: 1
1: 0
2: 4
3: 116
4: 3317
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081721_1003081727 -1 Left 1003081721 6:3026629-3026651 CCCAGGAGGAGCTTGAAATCCTG 0: 1
1: 0
2: 4
3: 116
4: 3317
Right 1003081727 6:3026651-3026673 GTCTGGGATCCTGACGGCCCAGG 0: 1
1: 0
2: 3
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081721 Original CRISPR CAGGATTTCAAGCTCCTCCT GGG (reversed) Intergenic