ID: 1003081722

View in Genome Browser
Species Human (GRCh38)
Location 6:3026630-3026652
Sequence ACAGGATTTCAAGCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 569}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081722_1003081727 -2 Left 1003081722 6:3026630-3026652 CCAGGAGGAGCTTGAAATCCTGT 0: 1
1: 0
2: 2
3: 22
4: 569
Right 1003081727 6:3026651-3026673 GTCTGGGATCCTGACGGCCCAGG 0: 1
1: 0
2: 3
3: 9
4: 139
1003081722_1003081725 -8 Left 1003081722 6:3026630-3026652 CCAGGAGGAGCTTGAAATCCTGT 0: 1
1: 0
2: 2
3: 22
4: 569
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081722_1003081730 15 Left 1003081722 6:3026630-3026652 CCAGGAGGAGCTTGAAATCCTGT 0: 1
1: 0
2: 2
3: 22
4: 569
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081722_1003081732 16 Left 1003081722 6:3026630-3026652 CCAGGAGGAGCTTGAAATCCTGT 0: 1
1: 0
2: 2
3: 22
4: 569
Right 1003081732 6:3026669-3026691 CCAGGTGCTGACCCTGCCTCGGG 0: 1
1: 1
2: 4
3: 34
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081722 Original CRISPR ACAGGATTTCAAGCTCCTCC TGG (reversed) Intergenic