ID: 1003081723

View in Genome Browser
Species Human (GRCh38)
Location 6:3026634-3026656
Sequence GAGGAGCTTGAAATCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081713_1003081723 19 Left 1003081713 6:3026592-3026614 CCTCAGTCCTGTCAGGAGAAACC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081716_1003081723 -2 Left 1003081716 6:3026613-3026635 CCTTCCCCACTAGAATCCCAGGA 0: 1
1: 0
2: 3
3: 17
4: 273
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081714_1003081723 12 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081720_1003081723 -8 Left 1003081720 6:3026619-3026641 CCACTAGAATCCCAGGAGGAGCT 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081718_1003081723 -6 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081711_1003081723 28 Left 1003081711 6:3026583-3026605 CCAGTGTGTCCTCAGTCCTGTCA 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1003081719_1003081723 -7 Left 1003081719 6:3026618-3026640 CCCACTAGAATCCCAGGAGGAGC 0: 1
1: 0
2: 4
3: 15
4: 108
Right 1003081723 6:3026634-3026656 GAGGAGCTTGAAATCCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081723 Original CRISPR GAGGAGCTTGAAATCCTGTC TGG Intergenic