ID: 1003081725

View in Genome Browser
Species Human (GRCh38)
Location 6:3026645-3026667
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081713_1003081725 30 Left 1003081713 6:3026592-3026614 CCTCAGTCCTGTCAGGAGAAACC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081720_1003081725 3 Left 1003081720 6:3026619-3026641 CCACTAGAATCCCAGGAGGAGCT 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081718_1003081725 5 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081716_1003081725 9 Left 1003081716 6:3026613-3026635 CCTTCCCCACTAGAATCCCAGGA 0: 1
1: 0
2: 3
3: 17
4: 273
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081714_1003081725 23 Left 1003081714 6:3026599-3026621 CCTGTCAGGAGAAACCTTCCCCA 0: 1
1: 0
2: 2
3: 30
4: 264
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081722_1003081725 -8 Left 1003081722 6:3026630-3026652 CCAGGAGGAGCTTGAAATCCTGT 0: 1
1: 0
2: 2
3: 22
4: 569
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081721_1003081725 -7 Left 1003081721 6:3026629-3026651 CCCAGGAGGAGCTTGAAATCCTG 0: 1
1: 0
2: 4
3: 116
4: 3317
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132
1003081719_1003081725 4 Left 1003081719 6:3026618-3026640 CCCACTAGAATCCCAGGAGGAGC 0: 1
1: 0
2: 4
3: 15
4: 108
Right 1003081725 6:3026645-3026667 AATCCTGTCTGGGATCCTGACGG 0: 1
1: 0
2: 1
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081725 Original CRISPR AATCCTGTCTGGGATCCTGA CGG Intergenic