ID: 1003081726

View in Genome Browser
Species Human (GRCh38)
Location 6:3026648-3026670
Sequence GGGCCGTCAGGATCCCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081726_1003081730 -3 Left 1003081726 6:3026648-3026670 CCTGTCTGGGATCCTGACGGCCC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081726_1003081732 -2 Left 1003081726 6:3026648-3026670 CCTGTCTGGGATCCTGACGGCCC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1003081732 6:3026669-3026691 CCAGGTGCTGACCCTGCCTCGGG 0: 1
1: 1
2: 4
3: 34
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081726 Original CRISPR GGGCCGTCAGGATCCCAGAC AGG (reversed) Intergenic