ID: 1003081730

View in Genome Browser
Species Human (GRCh38)
Location 6:3026668-3026690
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1556
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 1484}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003081718_1003081730 28 Left 1003081718 6:3026617-3026639 CCCCACTAGAATCCCAGGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 188
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081721_1003081730 16 Left 1003081721 6:3026629-3026651 CCCAGGAGGAGCTTGAAATCCTG 0: 1
1: 0
2: 4
3: 116
4: 3317
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081719_1003081730 27 Left 1003081719 6:3026618-3026640 CCCACTAGAATCCCAGGAGGAGC 0: 1
1: 0
2: 4
3: 15
4: 108
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081720_1003081730 26 Left 1003081720 6:3026619-3026641 CCACTAGAATCCCAGGAGGAGCT 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081722_1003081730 15 Left 1003081722 6:3026630-3026652 CCAGGAGGAGCTTGAAATCCTGT 0: 1
1: 0
2: 2
3: 22
4: 569
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484
1003081726_1003081730 -3 Left 1003081726 6:3026648-3026670 CCTGTCTGGGATCCTGACGGCCC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1003081730 6:3026668-3026690 CCCAGGTGCTGACCCTGCCTCGG 0: 1
1: 0
2: 4
3: 67
4: 1484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003081730 Original CRISPR CCCAGGTGCTGACCCTGCCT CGG Intergenic