ID: 1003083907 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:3045687-3045709 |
| Sequence | CAGGTGAAGCAGCAGCTGGA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1003083902_1003083907 | 12 | Left | 1003083902 | 6:3045652-3045674 | CCAAAGATTCAATAGATGCTGGG | 0: 4 1: 1 2: 3 3: 7 4: 98 |
||
| Right | 1003083907 | 6:3045687-3045709 | CAGGTGAAGCAGCAGCTGGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1003083907 | Original CRISPR | CAGGTGAAGCAGCAGCTGGA CGG | Intergenic | ||
| No off target data available for this crispr | |||||