ID: 1003083907

View in Genome Browser
Species Human (GRCh38)
Location 6:3045687-3045709
Sequence CAGGTGAAGCAGCAGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003083902_1003083907 12 Left 1003083902 6:3045652-3045674 CCAAAGATTCAATAGATGCTGGG 0: 4
1: 1
2: 3
3: 7
4: 98
Right 1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003083907 Original CRISPR CAGGTGAAGCAGCAGCTGGA CGG Intergenic
No off target data available for this crispr