ID: 1003085148

View in Genome Browser
Species Human (GRCh38)
Location 6:3054566-3054588
Sequence GTGGCTATAAAAACGCAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003085143_1003085148 4 Left 1003085143 6:3054539-3054561 CCCAGGAGTTAGGGAGGCGGCGG No data
Right 1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG 0: 2
1: 0
2: 0
3: 12
4: 72
1003085145_1003085148 3 Left 1003085145 6:3054540-3054562 CCAGGAGTTAGGGAGGCGGCGGG No data
Right 1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG 0: 2
1: 0
2: 0
3: 12
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003085148 Original CRISPR GTGGCTATAAAAACGCAACC CGG Intergenic
901274768 1:7982580-7982602 GTGGCTAAAACATCGCAAACAGG - Intronic
904459553 1:30668041-30668063 GTGGCTATAAACACAGACCCTGG - Intergenic
904893495 1:33796973-33796995 GTGGCGAAAAAAACCCACCCTGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
908318816 1:62961339-62961361 TTGGCTATAAAAATGCACCTTGG + Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
921600287 1:217099549-217099571 GTGGCTAGAAAATAGCATCCTGG - Intronic
924728257 1:246689834-246689856 GCTGCTATAAAAACGGCACCAGG - Intergenic
1066672238 10:37852515-37852537 GTGGCTATAAAAAGGGCAACAGG + Intronic
1076270987 10:129151969-129151991 TTGGCTCTAAAAATCCAACCTGG - Intergenic
1079776014 11:24528679-24528701 GTGGCCATAACAAAGCAACCTGG + Intronic
1079781700 11:24615272-24615294 ATGGCTATAAAAAAGCAAAAAGG - Intronic
1080565517 11:33505776-33505798 CTGGCCATAAAAAAGCAAACTGG - Intergenic
1081570455 11:44287401-44287423 GGGGCTATAAAATGGAAACCTGG - Intronic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1097977972 12:65708455-65708477 AGGGCTTTAAAAACTCAACCCGG - Intergenic
1102921479 12:116794767-116794789 GTAGCTAAAAAAACAAAACCAGG + Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1121106362 14:91282488-91282510 GATGCTATAAAAAAGCAACAGGG - Intronic
1125204456 15:37137187-37137209 GTTGCTTTCAAAACACAACCAGG - Intergenic
1125264840 15:37867067-37867089 GTGGCTGTAATAACGAAGCCAGG - Intergenic
1128532322 15:68462934-68462956 TTGGCTATCACAGCGCAACCAGG + Intergenic
1129625196 15:77190016-77190038 GTGGCTATAAACATTCAAGCAGG - Intronic
1132409276 15:101564533-101564555 GTGGCTACAAAAAGGCCATCTGG + Intergenic
1134113895 16:11533874-11533896 GTGGCCATAAAAACGCTGGCTGG + Intergenic
1134805266 16:17118820-17118842 GTGGCTAAAACAAGGCATCCTGG - Intronic
1138909900 16:61384037-61384059 GAGTATATAAAAACGCAACCTGG + Intergenic
1141644126 16:85358333-85358355 GAGGCCATAAAAACGCATCATGG - Intronic
1146545696 17:33736175-33736197 GGGGCTATAAAGAGGCCACCTGG + Intronic
1146979164 17:37143479-37143501 GTGGCTATGAAAATACCACCAGG + Intronic
1153190198 18:2529512-2529534 GTGTCTATAAAAAAGCCTCCTGG - Intergenic
1153483120 18:5567211-5567233 TTGGCAATACAAACGCAAACCGG + Intronic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1158467970 18:57708219-57708241 GTGGCTTTAAAAAAGCAATCAGG - Intronic
1161390550 19:4018312-4018334 GTGGTTATAAAATAGCAGCCAGG - Intronic
926994949 2:18724636-18724658 GTGGCTAGAATAAAGCAAGCAGG + Intergenic
928246858 2:29637925-29637947 GTTGCTATTAAAACTCAAGCTGG + Intronic
935126315 2:100226597-100226619 GTGGCTATAAAACATCAACAGGG - Intergenic
938222015 2:129577458-129577480 GTGGCTATAAAAACAGAGCCTGG - Intergenic
942637827 2:178027612-178027634 GTGGCTTTAAAAAAACAGCCGGG - Intronic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
1168754286 20:305284-305306 GTGCCTATAAAAACCCTAGCAGG + Intergenic
1170212382 20:13858293-13858315 TTGGCTCTAGAAACGCAGCCAGG + Intronic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
954834844 3:53457022-53457044 GTAGTTATAAAAACGGAACATGG + Intergenic
960074244 3:113466122-113466144 TTGGCTATAAATAAGCAAACAGG + Intronic
964622426 3:158731081-158731103 GTTCCTAGAAAAAGGCAACCTGG - Intronic
967164729 3:186770471-186770493 GTGGCTATTAAAGGGCAACATGG - Intergenic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
970997122 4:22280390-22280412 ATGGCTATAAAAACCAAAACAGG - Intergenic
972664776 4:41154409-41154431 CTGGTTATGGAAACGCAACCAGG - Intronic
973120704 4:46518387-46518409 GTGGCTAGAATAAAGCAAGCAGG - Intergenic
979271814 4:118771372-118771394 CTGGCTATAAAAACCTCACCTGG + Intronic
981937571 4:150251857-150251879 GTGGCCACATAAACGCAGCCGGG - Intronic
981947788 4:150369411-150369433 TTACCTATAAAAAGGCAACCTGG - Intronic
983058923 4:163132591-163132613 GTGACTATAAAGAGGCAACTGGG + Intronic
985608935 5:875645-875667 GTTGCTATAAAAAAGCATCTGGG - Intronic
987001329 5:13663305-13663327 GGGGCTATAAGAACCCAACTAGG + Intergenic
996518314 5:124398250-124398272 ATGGCTACAAAAAGTCAACCAGG + Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1002981786 6:2144981-2145003 TGGGCAATAAAAAGGCAACCTGG + Intronic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1005244733 6:23869933-23869955 GTGGCTATAAAAGGGAAACAGGG + Intergenic
1012012548 6:93807403-93807425 GTTCCTACAAAAAGGCAACCTGG - Intergenic
1014975351 6:127874735-127874757 ATGGCTATAAAAAAGCAACATGG + Intronic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1027478160 7:78659661-78659683 GTGGCTATAAAAGGACAACATGG + Intronic
1028145509 7:87316049-87316071 GTGGCTTTAAAAAGGCAAATCGG + Intergenic
1028567122 7:92245907-92245929 GTGGCTATGAAATCGCTTCCGGG + Exonic
1028579748 7:92395838-92395860 GTGGCTTTAAAAACGTGACCAGG - Intronic
1036494584 8:9258684-9258706 GGGGCTATAAAAACTCAGCTGGG + Intergenic
1036635035 8:10543342-10543364 GGGGCTATAAAAATGTCACCAGG - Intronic
1037213570 8:16421901-16421923 GCGGGTATATAAAAGCAACCGGG + Intronic
1040943662 8:52858313-52858335 GTGGCTATAAAAGGGGAACTTGG - Intergenic
1041389887 8:57338841-57338863 GTGAGTATAAAACCACAACCTGG - Intergenic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1047619352 8:126590571-126590593 GTGGCCATAAGAAGGCCACCGGG + Intergenic
1051547468 9:18292584-18292606 GTGGCTAGAATAAAGCAAGCAGG + Intergenic
1053230464 9:36403421-36403443 GTGGCTTTAAAAACTGATCCTGG - Intronic
1054355534 9:64057807-64057829 GTGACTATAAAGCCACAACCTGG - Intergenic
1193643133 X:84036154-84036176 GTGGCTATAAAAGACCAACATGG - Intergenic
1196948867 X:120855808-120855830 GTGGCCCTAAAAAGGCAAACAGG - Intergenic
1200333870 X:155326946-155326968 GTGGCTTTAAAAGGGCAACACGG + Intronic