ID: 1003086221

View in Genome Browser
Species Human (GRCh38)
Location 6:3063678-3063700
Sequence CTGAAGAGGCCCTGGCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003086209_1003086221 18 Left 1003086209 6:3063637-3063659 CCCAACCTACTTCTCTGGGCTGT No data
Right 1003086221 6:3063678-3063700 CTGAAGAGGCCCTGGCGCCGGGG No data
1003086210_1003086221 17 Left 1003086210 6:3063638-3063660 CCAACCTACTTCTCTGGGCTGTC No data
Right 1003086221 6:3063678-3063700 CTGAAGAGGCCCTGGCGCCGGGG No data
1003086212_1003086221 13 Left 1003086212 6:3063642-3063664 CCTACTTCTCTGGGCTGTCAGGT No data
Right 1003086221 6:3063678-3063700 CTGAAGAGGCCCTGGCGCCGGGG No data
1003086206_1003086221 27 Left 1003086206 6:3063628-3063650 CCGCAGGCTCCCAACCTACTTCT No data
Right 1003086221 6:3063678-3063700 CTGAAGAGGCCCTGGCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003086221 Original CRISPR CTGAAGAGGCCCTGGCGCCG GGG Intergenic
No off target data available for this crispr