ID: 1003087132

View in Genome Browser
Species Human (GRCh38)
Location 6:3068948-3068970
Sequence GCCCGACTTCCGGTACCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003087132_1003087143 -5 Left 1003087132 6:3068948-3068970 CCCGCCGGTACCGGAAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1003087143 6:3068966-3068988 CGGGCGGTGGGCGGGGCCGCGGG 0: 1
1: 0
2: 28
3: 112
4: 938
1003087132_1003087142 -6 Left 1003087132 6:3068948-3068970 CCCGCCGGTACCGGAAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1003087142 6:3068965-3068987 TCGGGCGGTGGGCGGGGCCGCGG 0: 1
1: 0
2: 10
3: 103
4: 810
1003087132_1003087146 12 Left 1003087132 6:3068948-3068970 CCCGCCGGTACCGGAAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1003087146 6:3068983-3069005 CGCGGGCGCTCCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 50
1003087132_1003087148 14 Left 1003087132 6:3068948-3068970 CCCGCCGGTACCGGAAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1003087148 6:3068985-3069007 CGGGCGCTCCCGGAAGTCAGGGG 0: 1
1: 0
2: 1
3: 7
4: 89
1003087132_1003087144 4 Left 1003087132 6:3068948-3068970 CCCGCCGGTACCGGAAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1003087144 6:3068975-3068997 GGCGGGGCCGCGGGCGCTCCCGG 0: 1
1: 1
2: 9
3: 60
4: 581
1003087132_1003087151 26 Left 1003087132 6:3068948-3068970 CCCGCCGGTACCGGAAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1003087151 6:3068997-3069019 GAAGTCAGGGGTGCTCCGCTAGG No data
1003087132_1003087147 13 Left 1003087132 6:3068948-3068970 CCCGCCGGTACCGGAAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1003087147 6:3068984-3069006 GCGGGCGCTCCCGGAAGTCAGGG 0: 1
1: 0
2: 0
3: 1
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003087132 Original CRISPR GCCCGACTTCCGGTACCGGC GGG (reversed) Intronic
900413862 1:2526235-2526257 GCCGGACTACAGCTACCGGCAGG - Intronic
1079249733 11:18778710-18778732 GCCCTGCTTCCTGTACAGGCTGG + Intronic
1092033031 12:5305664-5305686 GCCCCACTTCCGGTGCTTGCTGG - Intergenic
1094491108 12:30961291-30961313 GCTTGACTTCTGGTACCAGCAGG + Intronic
1096556270 12:52406031-52406053 GCCTGGCTTCGGGTACCGACTGG - Exonic
1130339350 15:82986191-82986213 ACCTGACTTCCGCTTCCGGCGGG - Exonic
1139346902 16:66309625-66309647 GCCCGACTTCCTGGACTGCCGGG - Intergenic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1157627011 18:49059580-49059602 GCCTGACTTCCGGAACAGCCAGG - Intronic
1161123574 19:2543671-2543693 GCCTGACTTCCTGTGCCGTCAGG - Intronic
1162953168 19:14083792-14083814 GCCCTACTTCCTGTACCTGGAGG - Exonic
1168337649 19:55605575-55605597 GCGCGACTTCCGCTTCCGGGCGG + Intronic
933362356 2:81304457-81304479 GCCGGACTTGGGGTACCAGCTGG - Intergenic
942830988 2:180237389-180237411 GCCAGACTCCGGGTACCCGCTGG + Intergenic
943960440 2:194256186-194256208 GCCGGACTCGGGGTACCGGCCGG - Intergenic
1173973866 20:47172806-47172828 GCTGGCCTTCCGCTACCGGCGGG + Exonic
1180170666 21:46056656-46056678 GCCCGAGTTCCGGGACCGTGTGG - Intergenic
1184677706 22:46052800-46052822 GCCCCACTCCCGGAACAGGCCGG + Intronic
956978903 3:74614355-74614377 GCCCGACTCCTGGCGCCGGCCGG - Intergenic
965751520 3:171979446-171979468 GCCCGACCTCCAGTACCGCGCGG + Intergenic
991692017 5:69234755-69234777 GCCCCACTTCAGGCACCGACAGG + Intergenic
1003087132 6:3068948-3068970 GCCCGACTTCCGGTACCGGCGGG - Intronic
1006770320 6:36547480-36547502 GCGCGACTTCCCGGAGCGGCCGG + Intergenic
1012746873 6:103102479-103102501 GCCCTACTTCAGGTAGAGGCTGG - Intergenic
1029440800 7:100585797-100585819 GCCCGACTCCCGGGCCGGGCGGG + Intronic
1049628165 8:143636015-143636037 TCGCGACTTCCGGTCGCGGCGGG + Intronic