ID: 1003090830

View in Genome Browser
Species Human (GRCh38)
Location 6:3101340-3101362
Sequence AGCTCTTTGGGAGGACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230532
Summary {0: 1, 1: 20, 2: 1613, 3: 67232, 4: 161666}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003090830 Original CRISPR AGCTCTTTGGGAGGACAAGC TGG Intronic
Too many off-targets to display for this crispr