ID: 1003094600

View in Genome Browser
Species Human (GRCh38)
Location 6:3132383-3132405
Sequence CCCCATGTGGGCCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 229}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003094588_1003094600 27 Left 1003094588 6:3132333-3132355 CCGACTTCCCTCCTCTCTCAGGC 0: 1
1: 1
2: 7
3: 70
4: 675
Right 1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 229
1003094592_1003094600 16 Left 1003094592 6:3132344-3132366 CCTCTCTCAGGCTGTTCCCTGGC 0: 1
1: 0
2: 2
3: 40
4: 385
Right 1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 229
1003094593_1003094600 0 Left 1003094593 6:3132360-3132382 CCCTGGCTGACACGTGCCTGCTC 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 229
1003094590_1003094600 19 Left 1003094590 6:3132341-3132363 CCTCCTCTCTCAGGCTGTTCCCT 0: 1
1: 0
2: 6
3: 84
4: 544
Right 1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 229
1003094586_1003094600 28 Left 1003094586 6:3132332-3132354 CCCGACTTCCCTCCTCTCTCAGG 0: 1
1: 2
2: 1
3: 46
4: 494
Right 1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 229
1003094594_1003094600 -1 Left 1003094594 6:3132361-3132383 CCTGGCTGACACGTGCCTGCTCC 0: 1
1: 1
2: 1
3: 23
4: 182
Right 1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 229
1003094589_1003094600 20 Left 1003094589 6:3132340-3132362 CCCTCCTCTCTCAGGCTGTTCCC 0: 1
1: 0
2: 3
3: 67
4: 561
Right 1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003094600 Original CRISPR CCCCATGTGGGCCACAGTGT TGG Intronic
900246027 1:1636510-1636532 CACCAAGTGGCCCACAGTGTTGG + Intronic
900257253 1:1703653-1703675 CACCAAGTGGCCCACAGTGTTGG + Intronic
900524627 1:3122498-3122520 CCCCAGGTGGGCCCCAGGGGAGG - Intronic
900959592 1:5910423-5910445 CCCCATGTGGCCCACATCTTGGG + Intronic
906200984 1:43960190-43960212 CCTCAAGTGGGTCACAGTGATGG + Intronic
906486165 1:46236835-46236857 CCCCAGATGGGCCACATTCTGGG - Intergenic
906696614 1:47827696-47827718 CTCATTGTGGGCCAAAGTGTTGG - Intronic
907576934 1:55534992-55535014 CCCCATGTGGGGCACTGGCTGGG + Intergenic
911053914 1:93694948-93694970 GCCCAGGTGGGCCAGAGTGTAGG - Intronic
914344343 1:146785591-146785613 CACCATTTTGGCCACAGTGCTGG + Intergenic
915058407 1:153158640-153158662 CCCCAGTTGGGACACTGTGTGGG + Intergenic
915625624 1:157112345-157112367 CTCCATGTGTGCCTCCGTGTGGG + Intergenic
916296736 1:163228149-163228171 CCCCCTGTGGGACTCTGTGTGGG + Intronic
917490670 1:175495572-175495594 CCCCATATGGGGTACAGTGGGGG - Intronic
919739090 1:200971850-200971872 CTCCATGTGGCGCCCAGTGTTGG - Intronic
923264946 1:232305359-232305381 CCCCATGTGGCCCACATTCTAGG - Intergenic
923670898 1:236040382-236040404 CCCCATCTCGTCCACAGTTTGGG + Intronic
1063556194 10:7081821-7081843 GCCCATGTTGCCCACAGAGTGGG - Intergenic
1064097795 10:12436679-12436701 CCCCATGGGGGCATCTGTGTGGG + Intronic
1064274528 10:13893758-13893780 ACCCACCTTGGCCACAGTGTTGG + Intronic
1069209430 10:65737563-65737585 CCCCATTTGGTCCCCAGTTTTGG + Intergenic
1070566233 10:77605653-77605675 CCTCAACTGGGCCAGAGTGTGGG - Intronic
1070590642 10:77798332-77798354 CCCCATGTGGTCCCGAGTGAAGG + Intronic
1070869035 10:79731926-79731948 CACCATATTGGCCACCGTGTTGG + Intergenic
1071252576 10:83835941-83835963 CTCCATGTGAGACACAGTGAGGG + Intergenic
1071635947 10:87254111-87254133 CACCATATTGGCCACCGTGTTGG + Intergenic
1075123294 10:119680149-119680171 CCCAAGGTGGGCCTCAGAGTGGG - Intergenic
1075169844 10:120103201-120103223 CCCCATGAGGTCCAAAGGGTGGG - Intergenic
1075807289 10:125198916-125198938 GACCATGTGGGTCACAGGGTAGG + Intergenic
1076057966 10:127390982-127391004 CCGCATGTGGGCGGCAGTGCTGG - Intronic
1077186167 11:1236335-1236357 CTCCCTGGGGGCCACAGGGTCGG + Intronic
1078170313 11:8924630-8924652 CCCCCAGTGGGTCCCAGTGTGGG + Intronic
1079511680 11:21217481-21217503 TACAATGTTGGCCACAGTGTAGG - Intronic
1081386651 11:42480375-42480397 CCCCAGTGGGGACACAGTGTGGG - Intergenic
1083703803 11:64499486-64499508 ACCCCTGTGGGCCACAGCCTTGG + Intergenic
1084760905 11:71270294-71270316 GCCCAGGTGGCCCACAGGGTAGG - Intergenic
1085444458 11:76591217-76591239 TCCCACCTTGGCCACAGTGTAGG + Intergenic
1085941803 11:81213971-81213993 CCCCAGGAGGGCCCCTGTGTGGG + Intergenic
1088900627 11:114114194-114114216 GTCCATGTCGGCCACAATGTTGG + Intronic
1089654374 11:119936074-119936096 CCCTATTTGGGGCACAATGTGGG + Intergenic
1090408436 11:126491473-126491495 TCCCATCTGGGCCAGACTGTTGG + Intronic
1090597459 11:128334966-128334988 CCCAATGTGGGCTGCAGTGAGGG + Intergenic
1091609729 12:1995671-1995693 GCCCATTTGGGGCAAAGTGTGGG - Intronic
1092153023 12:6264089-6264111 GCCCATGCTGGCCACAGTGAGGG - Intergenic
1092727163 12:11497780-11497802 CACCATGTGAGGCACAGAGTGGG - Intronic
1093007775 12:14068981-14069003 ACCCATGTGGGCCTCTCTGTAGG - Intergenic
1096785886 12:54017110-54017132 CCCCTTGGGGGCCAGAGGGTCGG - Intronic
1101231692 12:102747871-102747893 CCTCAAGTAGGCCCCAGTGTTGG + Intergenic
1102505450 12:113381617-113381639 CCCCACCTGGGCCACAGCATGGG - Intronic
1103701346 12:122850275-122850297 ACCTATGTGGGCCACAGCCTGGG + Intronic
1104357532 12:128101086-128101108 CCCCATGTTGGCCTCTCTGTAGG + Intergenic
1104428007 12:128693924-128693946 CCCCCTGTGTGTCACCGTGTGGG + Exonic
1104602927 12:130165122-130165144 CCCCAGGAAGGCCACAGTGCTGG + Exonic
1104793417 12:131498799-131498821 TTCCATTTGGGCCACAGTGATGG - Intergenic
1104975231 12:132549191-132549213 CGCCGTGTGGGCCGCAGTGCCGG + Intronic
1105312010 13:19220359-19220381 GCCCAGGTGGGCAACAGAGTGGG + Intergenic
1106202148 13:27548030-27548052 CTCCATCTGGGGCACAGTTTGGG + Exonic
1107932815 13:45320178-45320200 CAACATGTGGTCCACTGTGTGGG + Intergenic
1111304050 13:86383000-86383022 CCCCATGTGCGCCACATTACGGG + Intergenic
1112815545 13:103268574-103268596 CCCCAGTGGGGCCACTGTGTGGG - Intergenic
1113075954 13:106468296-106468318 ACCAATGTGGGCCACAGCCTTGG + Intergenic
1113642254 13:111965975-111965997 CGCCGTGTGGGCCACAGAGCAGG - Intergenic
1117073568 14:52078185-52078207 ACAGATGTGGGCCACAGAGTTGG - Intergenic
1118492975 14:66279771-66279793 CTCCATGTGGGCCTCACTATGGG - Intergenic
1119200578 14:72748982-72749004 CCCCAGGTGGGACTCTGTGTGGG - Intronic
1119476753 14:74934913-74934935 CACCACGTGGGCCACAGCGCTGG - Intergenic
1119646873 14:76354533-76354555 TCCCATTTGGGTCACAATGTTGG - Intronic
1120083003 14:80236719-80236741 CCCCATTGGGGACACAGTGTGGG + Intronic
1122632602 14:103113885-103113907 CCCAATGTGGGCAGCAGTGAGGG - Intergenic
1122642727 14:103169984-103170006 CCTCAGGATGGCCACAGTGTTGG + Intergenic
1122743083 14:103882933-103882955 CCACATGTGAGCCGCAGTCTTGG + Intergenic
1128194772 15:65742623-65742645 CACCATGTTGGCCATGGTGTTGG + Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1130520646 15:84658367-84658389 CCGCGTGCGGGCCAGAGTGTGGG - Exonic
1131308016 15:91262622-91262644 CCCCAAGTAGACCTCAGTGTTGG + Intronic
1132143942 15:99415695-99415717 CCCCAAGTGGGTGACAGTGCAGG - Intergenic
1132146353 15:99432130-99432152 CCCCATATGGGCAACAGAGAAGG - Intergenic
1132543519 16:522501-522523 CTCCAGGGGGGCCACAGGGTGGG + Exonic
1132571804 16:647500-647522 CTCCTCGTGGGCCACTGTGTAGG - Exonic
1132895980 16:2229601-2229623 CACGATGTGGGCCACAGTGATGG - Exonic
1132939427 16:2499574-2499596 CCCCTTGTGGCCCTGAGTGTGGG - Intronic
1132997638 16:2831455-2831477 TCATATGTGGGCCACAGTGACGG + Intronic
1133028600 16:2999149-2999171 CCCCATGTGGTCCCCAGTATGGG + Intergenic
1133125036 16:3641191-3641213 CTCCATGTGGGCCACAGGGGAGG + Intronic
1133710902 16:8400352-8400374 CCTCAAGTGGACCCCAGTGTGGG - Intergenic
1133792122 16:9017145-9017167 CCCAATTTTGGCCACACTGTGGG + Intergenic
1134307426 16:13045756-13045778 CCCCCTGGGGGACACAGTGGGGG - Intronic
1138883607 16:61047940-61047962 CACCATGTTGGCCAAAGTGCTGG + Intergenic
1139160023 16:64493908-64493930 CCTCATGTGATCCCCAGTGTGGG + Intergenic
1139989654 16:70929758-70929780 CACCATTTTGGCCACAGTGCTGG - Intronic
1141217015 16:82034116-82034138 CCCCATGTGGGCCACATGCCTGG - Intergenic
1141581374 16:85001819-85001841 TCCCATGTCGGCCAAAGTGCTGG + Intronic
1142061890 16:88035720-88035742 CCCCATCTCGGCCACACTGGGGG - Intronic
1142435034 16:90051111-90051133 CCCCAAGCGGGCCACATAGTAGG + Intergenic
1143576126 17:7794353-7794375 CCCCATGAGGTCCTCACTGTGGG - Exonic
1147609192 17:41791794-41791816 CCCCAGGAGGGCCAGAGTGGAGG - Intergenic
1152388511 17:79989388-79989410 CCCGATCAAGGCCACAGTGTGGG - Intronic
1152781961 17:82230682-82230704 CCAAATGTGGGCCACACTCTGGG + Intronic
1152992844 18:378499-378521 CACCCTGTGGGCCTCTGTGTTGG - Intronic
1153830985 18:8922380-8922402 ACCTTTATGGGCCACAGTGTTGG - Intergenic
1155183424 18:23367584-23367606 CCCCAAGGAGGTCACAGTGTAGG - Intronic
1156034696 18:32753425-32753447 ACCCATGTGAGCCACAGGGGCGG - Intronic
1156310657 18:35918901-35918923 CACCATTTTGGCCACAGTGAAGG + Intergenic
1156415431 18:36883501-36883523 TCCCATGTGGGACACTGTGAGGG - Intronic
1157203540 18:45679506-45679528 CCTCATCTGGGCTCCAGTGTAGG + Intronic
1157426488 18:47588789-47588811 CCCCAGCTTGGCCACAGTGATGG - Intergenic
1159718187 18:71851137-71851159 GCCCATGTGGAGCACAGTGTGGG - Intergenic
1160029685 18:75248390-75248412 AAACATGTGGGCCACAGTCTAGG - Intronic
1161684373 19:5695745-5695767 CCCCACCTGGCCCAGAGTGTAGG - Intronic
1161960015 19:7518017-7518039 CCCCACATGGGGAACAGTGTGGG - Intronic
1161988162 19:7669188-7669210 CCCCATGTGGGGGACAGGGATGG - Intronic
1162332338 19:10037999-10038021 CCCCATGAGGAAGACAGTGTTGG + Intergenic
1164462596 19:28461765-28461787 CCCCATGTCTGGCACATTGTAGG - Intergenic
1165314375 19:35045761-35045783 CCTCATCTGGCCCACGGTGTGGG - Intronic
1168144516 19:54413281-54413303 CCCCATGTAGGCCACCTGGTTGG + Intergenic
925293128 2:2761650-2761672 CCCAAGGTGAGACACAGTGTGGG - Intergenic
931246873 2:60499304-60499326 ACCCTTCTGGGCCACAGTGCTGG + Intronic
931288832 2:60854808-60854830 CTCCATGTGGGCTACAGCTTCGG + Intergenic
934536560 2:95139247-95139269 CCCCATTGGGGACACTGTGTGGG - Intronic
934929448 2:98409049-98409071 CCACGTTTGAGCCACAGTGTTGG - Intergenic
936646241 2:114376022-114376044 CCTCATGAGGGGCTCAGTGTTGG + Intergenic
937705091 2:124911388-124911410 TTCCAGGTGGGCCACACTGTAGG + Intronic
938647715 2:133348560-133348582 GCTAATGGGGGCCACAGTGTGGG - Intronic
944708587 2:202315362-202315384 CCCAGTGTTGGCCAGAGTGTAGG + Intergenic
945511892 2:210713326-210713348 CCACAGGTGGGGCACTGTGTGGG + Intergenic
946638580 2:221757865-221757887 CTCCATCTCTGCCACAGTGTTGG - Intergenic
947588644 2:231371896-231371918 CCCCAACAGGGCGACAGTGTAGG + Intronic
948306138 2:236948200-236948222 CCCCATGAGCCCCCCAGTGTGGG + Intergenic
948729218 2:239952709-239952731 CCCCATGTGGTGCACACCGTGGG - Intronic
1168983350 20:2026462-2026484 CCCCTTGTGTGCCACATTGCAGG - Intergenic
1169427637 20:5509186-5509208 CCCCAGGTGGGCACCAGTGATGG + Intergenic
1170774673 20:19364986-19365008 CTCCATGTGGACCACAGAGAGGG + Intronic
1171162957 20:22945048-22945070 CACCATGTGGGAGACACTGTGGG + Intergenic
1171184429 20:23114846-23114868 CGCCATGGGGCTCACAGTGTAGG + Intergenic
1172107620 20:32526241-32526263 GCCCATGTGGGCCCCAGCCTGGG + Intronic
1173557394 20:43975779-43975801 CCCCATGGTGGTCACAGTTTAGG - Intronic
1174067928 20:47878988-47879010 CCCCATATGGGCCATCCTGTGGG - Intergenic
1174404559 20:50294913-50294935 CCTCATGTGGCCCACAGTCCAGG + Intergenic
1174865235 20:54129415-54129437 CCTCAGGTAGGCCCCAGTGTCGG + Intergenic
1175231948 20:57479437-57479459 CCCAGTGTGGGGCACAGAGTGGG + Intergenic
1175954356 20:62600919-62600941 CCCCAACTGGGCCACACTCTGGG - Intergenic
1176021653 20:62965296-62965318 CCCCTTCTGGGCCCCAGTGCTGG - Intronic
1179681076 21:43021828-43021850 CCACAGGTGGGCCACCGGGTGGG + Intronic
1181541612 22:23575990-23576012 CACCATGTGGGCAATAGTGGGGG - Intronic
1181551485 22:23641325-23641347 CACCATGTGGGCAATAGTGGGGG - Intergenic
1181796773 22:25317316-25317338 CACCATGTGGGCAATAGTGGGGG + Intergenic
1181805174 22:25370250-25370272 CACCATGTTGGCCACCATGTTGG + Intronic
1183545194 22:38451705-38451727 ACCCATGAGGGTCACAGTGATGG - Intronic
1183619589 22:38964785-38964807 CCCCATGTGGGCGGCAGGGATGG - Intronic
1184643782 22:45885509-45885531 CCCCATGGGGCCCACAGAGTTGG + Intergenic
1185092140 22:48781600-48781622 CCCACTGTGGGCCCCAGCGTTGG + Intronic
950736758 3:15015564-15015586 CCCCACATGGGCCACAATTTTGG + Intronic
950860661 3:16144957-16144979 CCCCATTTGGCCCAGATTGTGGG - Intergenic
953413822 3:42704280-42704302 CCTCGTGAGGGCCCCAGTGTGGG - Intronic
953637666 3:44676570-44676592 CTCCAGGTGGGCCCCAGTGAGGG + Intergenic
956593581 3:70942774-70942796 CCCCAGGTGGGGCGCTGTGTTGG + Intergenic
959893166 3:111579329-111579351 CCACATGTGGGTAACAGTGCTGG + Intronic
963831519 3:150014260-150014282 TCCCATCTGGCCCACAGTTTCGG - Intronic
964905897 3:161720285-161720307 ACCAATGTGTGCCACACTGTGGG - Intergenic
965507217 3:169529867-169529889 CCCCATGTCAGACACTGTGTTGG + Intronic
967117829 3:186357620-186357642 CCCAATGTGGGACTCAGAGTCGG + Intronic
968530531 4:1089032-1089054 CCCCAGTTGGGACACTGTGTGGG - Intronic
971021954 4:22546108-22546130 CCCCAGTTGGGACACTGTGTGGG + Intergenic
973130154 4:46639412-46639434 CCCCATGAGGCCATCAGTGTAGG + Intergenic
973951134 4:56015480-56015502 GCCCCTGTGGGACACAGGGTGGG + Intronic
974894927 4:67927213-67927235 CCCCTTGCTGGCCACATTGTGGG + Intronic
983070519 4:163262623-163262645 TCCCATCTGGGCAACAGAGTGGG - Intergenic
984560981 4:181269815-181269837 TCCCCTGTGGACCACACTGTGGG - Intergenic
988354817 5:30160545-30160567 TCCCATCTGTTCCACAGTGTAGG - Intergenic
988735585 5:34017451-34017473 CCCAAAGTGGGCCAAAGTTTAGG - Intronic
991744251 5:69716689-69716711 CCACTTTTGGGCCACAGTTTGGG - Intergenic
991753455 5:69838547-69838569 CCACTTTTGGGCCACAGTTTGGG + Intergenic
991795823 5:70296413-70296435 CCACTTTTGGGCCACAGTTTGGG - Intergenic
991803072 5:70395274-70395296 CCACTTTTGGGCCACAGTTTGGG + Intergenic
991823625 5:70591957-70591979 CCACTTTTGGGCCACAGTTTGGG - Intergenic
991832774 5:70713672-70713694 CCACTTTTGGGCCACAGTTTGGG + Intergenic
991888193 5:71295932-71295954 CCACTTTTGGGCCACAGTTTGGG - Intergenic
993656509 5:90584631-90584653 CTCCATGTGAGCCACTCTGTGGG + Intronic
995869964 5:116734331-116734353 CCCCAGGTGGGCTCCAGTGTGGG - Intergenic
998311429 5:141136690-141136712 CCCCATGTCGGTGACAGTGATGG - Exonic
999500415 5:152141486-152141508 CCCCAAGTGGACCTCTGTGTTGG + Intergenic
999581517 5:153043668-153043690 CCCCTTGTGGACCCCATTGTTGG - Intergenic
1001746424 5:174096197-174096219 CCCCTCTTGGGACACAGTGTGGG - Intronic
1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG + Intronic
1003767372 6:9254447-9254469 CCCCAGGTGGTCCCCCGTGTCGG + Intergenic
1008538032 6:52522272-52522294 ACCCCTGTGGGACACAGTGTGGG - Intronic
1010325291 6:74556311-74556333 CCCCATGAGGCCATCAGTGTAGG + Intergenic
1014993978 6:128117896-128117918 ACCCACGTCGGCCAAAGTGTTGG + Intronic
1015910746 6:138165493-138165515 CCCCATGTGGGTCTCAGAGGGGG - Intronic
1016686550 6:146888833-146888855 CACCAGGTGGGCCACACTGGTGG - Intergenic
1016992299 6:149938555-149938577 CCTCGTGGGGGCCACACTGTCGG + Intergenic
1017054265 6:150423889-150423911 GGGCATGTGGGCCACAGTGGGGG - Intergenic
1018803749 6:167242705-167242727 CCCCATGAGGCCAACAGTGCAGG + Intergenic
1019187014 6:170226675-170226697 CCCCACGTGGTCAGCAGTGTAGG + Intergenic
1019491334 7:1314956-1314978 CCCCAGGTGGGCCTGGGTGTTGG - Intergenic
1019744479 7:2692014-2692036 CCCCTTGTGGGCGGCAGTGCTGG + Intronic
1019955685 7:4412560-4412582 CTCCATGTGGGCCAGTCTGTGGG + Intergenic
1022582929 7:31574790-31574812 GGGCAGGTGGGCCACAGTGTAGG + Intronic
1023586920 7:41740557-41740579 ACCCATGTGGGCCATACTTTGGG + Intergenic
1023702316 7:42904967-42904989 CTCTATGTGGGACACAGTCTGGG + Intergenic
1024000253 7:45184902-45184924 CCCCATTGGGGGCACAGTGTAGG + Intronic
1026595569 7:71731725-71731747 CACCATGTGGGCCTCTTTGTAGG + Intergenic
1026771471 7:73203501-73203523 CGCCATGTGTGCCACTGTGCAGG - Intergenic
1027075703 7:75189156-75189178 CGCCATGTGTGCCACTGTGCAGG + Intergenic
1029116644 7:98241118-98241140 CCTCCTGTGGGCCACACTCTGGG - Exonic
1029285557 7:99463402-99463424 TCCCATCTCGGCCAAAGTGTTGG - Intronic
1029861839 7:103580936-103580958 CTGCATTTGGGCCACAGTTTTGG + Intronic
1033227500 7:139573161-139573183 CACCAGGTGGGCCACGGTGCCGG + Exonic
1034086446 7:148326928-148326950 GCAGATGTGGGCCACAGTTTTGG + Intronic
1035974992 8:4300276-4300298 CCCCATCTGTGCCCAAGTGTAGG - Intronic
1038199604 8:25400019-25400041 TCCCAGGGAGGCCACAGTGTGGG + Intronic
1038782545 8:30580542-30580564 CCACATGTGGGACACGGTGCAGG + Intronic
1040900099 8:52409953-52409975 ACCCTTGTGGGCCACTGTGGAGG - Intronic
1040933563 8:52760565-52760587 ACCTTTGTGGGCCACTGTGTGGG + Intergenic
1041965148 8:63667627-63667649 CCCCATTTGGGACTCTGTGTGGG - Intergenic
1043154028 8:76755019-76755041 CCACATCTGGGCCACCCTGTGGG + Intronic
1044613957 8:94120434-94120456 CCCCCTGTTGGCCACTTTGTGGG + Intergenic
1044620777 8:94188717-94188739 CCCCATGTGGGCCATTGTCAAGG - Intronic
1044794665 8:95884881-95884903 CCCCATTTTGGCCACAGTACAGG - Intergenic
1045479076 8:102578163-102578185 CCTCATTTGGGGCACTGTGTTGG + Intergenic
1045992626 8:108327288-108327310 CCCTATTTTGTCCACAGTGTAGG + Intronic
1046155686 8:110287108-110287130 CCCAATGTTTACCACAGTGTTGG + Intergenic
1047942238 8:129837101-129837123 TCCCATGTGGGGCACAGCCTGGG + Intergenic
1048996850 8:139799828-139799850 CCCCATGCTCGGCACAGTGTGGG - Intronic
1049594768 8:143478217-143478239 CCCCATGTGAGCCTCAGTCAGGG - Intronic
1049749362 8:144276095-144276117 CCGCAGGTGGGCCGCACTGTTGG - Intronic
1049891437 9:73666-73688 CCCCAAGTGGGACTCACTGTCGG + Intergenic
1050268746 9:3919040-3919062 GACCATGTGGGTCTCAGTGTAGG + Intronic
1051434986 9:17021302-17021324 CCCCATCTGGGCCACAGTGCAGG + Intergenic
1053050825 9:34958979-34959001 CCACCTCTGGGCCACGGTGTGGG - Intronic
1053182342 9:35983952-35983974 CACCATGGTGGCCATAGTGTTGG + Intergenic
1056072041 9:82997453-82997475 CCACATGTGGGACACAGAGGAGG + Intronic
1057266716 9:93622215-93622237 CCTCATGTGGGCTTCAGTTTGGG + Intronic
1058210436 9:102161389-102161411 CCCCAATTGGGACACTGTGTGGG + Intergenic
1060984725 9:127813477-127813499 CCCACTGTGAGCCACAGGGTGGG - Exonic
1061508996 9:131049066-131049088 CCCCATTTGGGCTCCATTGTGGG - Exonic
1191850909 X:65585520-65585542 CACTATGTTGGCCACATTGTTGG - Intergenic
1193317278 X:80077952-80077974 CCCCATGTGTTCCTCAGTGGTGG + Intergenic
1194091536 X:89585236-89585258 CCTCATTTGGGTCCCAGTGTGGG + Intergenic
1197941606 X:131795842-131795864 CTCCTTGTGGGCCAGTGTGTAGG + Intergenic
1200040866 X:153367070-153367092 CCCAATGTTGGCAAGAGTGTGGG - Intergenic
1200091063 X:153636257-153636279 CCCCAAGGGAGCCACAGTGAAGG - Intergenic
1200444173 Y:3241298-3241320 CCTCATTTGGGTCCCAGTGTGGG + Intergenic
1201896129 Y:18994375-18994397 TCCCCTGTGGGCCACTGTGGAGG + Intergenic