ID: 1003095945

View in Genome Browser
Species Human (GRCh38)
Location 6:3143765-3143787
Sequence GATCTAAGCATATCAATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003095939_1003095945 13 Left 1003095939 6:3143729-3143751 CCAAAGGAGGTCACACTCTGAGA 0: 1
1: 1
2: 14
3: 188
4: 995
Right 1003095945 6:3143765-3143787 GATCTAAGCATATCAATATGAGG 0: 1
1: 0
2: 1
3: 13
4: 141
1003095938_1003095945 14 Left 1003095938 6:3143728-3143750 CCCAAAGGAGGTCACACTCTGAG 0: 1
1: 0
2: 5
3: 60
4: 253
Right 1003095945 6:3143765-3143787 GATCTAAGCATATCAATATGAGG 0: 1
1: 0
2: 1
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003095945 Original CRISPR GATCTAAGCATATCAATATG AGG Intronic
901197608 1:7448831-7448853 GATTTCAGCATATGAATTTGGGG + Intronic
907166581 1:52416729-52416751 GATATAAGGATATCTGTATGTGG + Exonic
908846372 1:68328738-68328760 GATTTCAGCATATGAATTTGGGG - Intergenic
908986886 1:70034927-70034949 GACCTGAGCATGTCACTATGGGG + Intronic
909610257 1:77544130-77544152 TATCTAAACATATCAAAATATGG + Intronic
910008100 1:82425012-82425034 TGTCTAAGGATATCAATATCTGG + Intergenic
910071603 1:83221074-83221096 GATTTCAGCATATAAATTTGTGG + Intergenic
911419730 1:97625482-97625504 GACTTCAGCATATCAATTTGAGG - Intronic
913120942 1:115740229-115740251 TGTCTAAGCATATGGATATGAGG + Intronic
915746872 1:158167951-158167973 GAACTAAGCAAATCAACATATGG + Intergenic
916966529 1:169950321-169950343 GATTTAAGTATAACAATATGTGG - Intronic
918105209 1:181410799-181410821 GATCTAACCATATCATTTTATGG - Intergenic
919155178 1:193755082-193755104 GATCTAAGGCCATCAAAATGAGG + Intergenic
924867969 1:248006617-248006639 GATTTAAGCATATGGATTTGGGG - Intronic
1064051138 10:12060520-12060542 GATGTAAGAATAGGAATATGAGG - Intergenic
1064917662 10:20479330-20479352 GATCTAATCATATTTATTTGAGG + Intergenic
1066124543 10:32327778-32327800 GATCTAAGCATATCTAAACATGG + Intronic
1072983964 10:100123133-100123155 CTTCAAAGCAAATCAATATGGGG + Intergenic
1073555814 10:104450106-104450128 GAGCAAAGAATATAAATATGAGG + Exonic
1076130945 10:128013558-128013580 GATTTCAGCATATAAATCTGGGG - Intronic
1077980408 11:7294225-7294247 GATCTCAACATATGAATTTGGGG + Intronic
1079516771 11:21278548-21278570 AATCTAAGTATATCATTTTGGGG - Intronic
1079866023 11:25735171-25735193 GAGCTAATCATATCAACGTGAGG + Intergenic
1080392097 11:31857865-31857887 GATTTCAGCATATGAATTTGGGG - Intronic
1080878083 11:36294809-36294831 GATTTCAGCATATGAATTTGTGG + Intergenic
1081355279 11:42105167-42105189 TCTCTAAGCCAATCAATATGTGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1086753331 11:90527389-90527411 GATCTAAGTTTATGAATATGAGG + Intergenic
1087667409 11:101066628-101066650 GCTCTAAACATATTAATTTGAGG - Intronic
1089979017 11:122757201-122757223 GATTTCAGCATATGAATTTGGGG - Intronic
1090283560 11:125479551-125479573 GATTTTAGCATATAAATTTGGGG - Intronic
1093080700 12:14807337-14807359 GAGCTAAGCATTTCAAATTGGGG - Intronic
1095379514 12:41573286-41573308 GATGTTTGCATATCTATATGAGG - Exonic
1097557082 12:61151854-61151876 GAACTAAGAAAATCAATATTTGG + Intergenic
1099384890 12:82002427-82002449 GATTTAAGAATATCAACATCAGG + Intergenic
1099842934 12:87989508-87989530 AATCTAAGCATATAAATGTATGG - Intronic
1100578414 12:95914918-95914940 AATCTAATCAAATAAATATGAGG - Intronic
1103420430 12:120777019-120777041 GATTTAAGTGTATCATTATGGGG + Intronic
1108271388 13:48763249-48763271 GATCTAAGCTTATCTATAAATGG - Intergenic
1108591861 13:51919595-51919617 GATCTGTGTGTATCAATATGGGG - Intergenic
1109079601 13:57881748-57881770 GATCTCTGAATAACAATATGGGG - Intergenic
1111830376 13:93322081-93322103 GATCTAATAATAACAATTTGGGG - Intronic
1112375834 13:98839949-98839971 AAGCAAAGCATAACAATATGTGG - Intronic
1113365260 13:109669858-109669880 GATCTAAGCATATGTCTCTGAGG - Intergenic
1114902462 14:27081209-27081231 GATCTAAGCAAAACAACATGAGG + Intergenic
1118429884 14:65706793-65706815 GATTTCAGCATATGAATTTGGGG + Intronic
1118546588 14:66896175-66896197 GATATCAGCATATGAATTTGGGG + Intronic
1119577185 14:75735567-75735589 TTTCTGAGCATATCAATCTGAGG - Intronic
1120144679 14:80967028-80967050 GATTTCAGCATATGAATTTGGGG + Intronic
1120540725 14:85747508-85747530 GATTTCAGCATATGAATTTGGGG - Intergenic
1120967612 14:90181532-90181554 GATCTCAACATATGAATTTGGGG + Intronic
1128860765 15:71069739-71069761 GATCTCAGCATATATATCTGGGG + Intergenic
1131213968 15:90521572-90521594 GTTATAAACATATCAAGATGTGG - Intergenic
1131342737 15:91617918-91617940 GATTTAAACATATGAATTTGGGG - Intergenic
1132011005 15:98276714-98276736 GATTTCAGCATATGAATTTGGGG - Intergenic
1137680709 16:50342402-50342424 AATCTCTGCTTATCAATATGTGG + Intronic
1139002292 16:62527252-62527274 GATCTAAGCATATTAATCTTAGG + Intergenic
1139232804 16:65302653-65302675 TATCTAAGCATATAATTTTGAGG - Intergenic
1139339206 16:66256990-66257012 GACTTAAGCATATCTTTATGGGG + Intergenic
1145809146 17:27754410-27754432 AATCTAAGCCCATTAATATGAGG + Intergenic
1148000197 17:44383377-44383399 GTTTTAAGCATATAAGTATGTGG - Intronic
1156214926 18:34988126-34988148 GATACAAGTATATGAATATGTGG - Intronic
1159717141 18:71839182-71839204 GATCTAATAATATCAAAATATGG + Intergenic
926355657 2:12038681-12038703 GATTTCAGCATATTAATTTGGGG + Intergenic
927346704 2:22052446-22052468 AATATAAGCATATTTATATGTGG + Intergenic
928070871 2:28214904-28214926 TATTTAAGCATGGCAATATGGGG - Intronic
943055596 2:182974441-182974463 GAGCTAAGCACATAAAAATGAGG + Intronic
945411040 2:209507146-209507168 GATCTCAACATATGAATTTGGGG + Intronic
947075553 2:226340713-226340735 TATATAAACATATCACTATGTGG - Intergenic
948330132 2:237158015-237158037 TATCTAAACATATCCAAATGTGG - Intergenic
1169721038 20:8676617-8676639 GACCTAAAGATATCAATATTAGG + Intronic
1170237959 20:14128843-14128865 GATGACAGCATATCAATTTGTGG + Intronic
1177342951 21:19828235-19828257 GCACAAAGCATGTCAATATGTGG + Intergenic
1177673452 21:24265600-24265622 GATAGAAGCATTTTAATATGAGG + Intergenic
1177708009 21:24734313-24734335 GATGTAAGTATATCAAGATATGG + Intergenic
1179287326 21:39989041-39989063 GATGTAAGCAAATTAAGATGCGG - Intergenic
1181787091 22:25235242-25235264 GATTTCAGCATATGAATTTGGGG - Intergenic
1181819086 22:25461846-25461868 GATTTCAGCATATGAATTTGGGG - Intergenic
1184313368 22:43663701-43663723 GGTCTAAACATATGAATTTGGGG - Intronic
949808380 3:7979167-7979189 GATCTCAAAATATAAATATGCGG + Intergenic
950703112 3:14763523-14763545 GATTTCAGCATATCAATTTGGGG + Intronic
951507913 3:23469244-23469266 GATTTAAACATATCAATTTGTGG + Intronic
952683154 3:36118997-36119019 GATTTAAGCATGTAAATATCTGG + Intergenic
957434601 3:80158505-80158527 AAAATAAGCATAACAATATGGGG + Intergenic
958094155 3:88919942-88919964 GATCTATGCCTTTAAATATGAGG - Intergenic
960419717 3:117428862-117428884 CATCTAAGCATGTAAACATGTGG + Intergenic
961342237 3:126234782-126234804 TCTCTTAGCATATCAATGTGGGG + Intergenic
962351812 3:134661815-134661837 GATCTCAACATATGAATTTGAGG - Intronic
964082053 3:152771360-152771382 GATCTAAAGATTTTAATATGTGG + Intergenic
967670358 3:192226572-192226594 GATTTAAGCATAAGAATTTGAGG - Intronic
970979980 4:22084991-22085013 GATCTTAGCATGACTATATGTGG + Intergenic
971286231 4:25292623-25292645 TATGTAAGTATATGAATATGTGG + Intergenic
971846236 4:31922574-31922596 GATTTATGCATGTAAATATGGGG - Intergenic
972383026 4:38536612-38536634 GATTTCAGCATATCAATTTTGGG - Intergenic
974688942 4:65270316-65270338 GATTTCAGCATATGAATATTGGG + Intergenic
975233352 4:71960985-71961007 GATTTCAGCATATTAATTTGGGG - Intergenic
976330640 4:83827424-83827446 CATGTAAGCACAGCAATATGTGG - Intergenic
976853328 4:89574800-89574822 GTTCTAAGCATACCCATCTGTGG - Intergenic
977661275 4:99589651-99589673 GTTCTACTCATATCAAAATGAGG + Exonic
979562707 4:122118402-122118424 GCTCTAAGGATAACAATATTGGG + Intergenic
981513896 4:145586593-145586615 GAACTATGCATTTCAATATTTGG + Intergenic
983037047 4:162879612-162879634 AATTTAAGCATATAAACATGAGG - Intergenic
988485228 5:31662968-31662990 GATTTCAGCATATGAATTTGGGG + Intronic
989196796 5:38724182-38724204 GATTTCAGCATATCAATTTTGGG + Intergenic
989728636 5:44619990-44620012 GATCTAAGGATGTCTATATGAGG - Intergenic
990182503 5:53177341-53177363 CATCTAGGCAGATCAATATATGG - Intergenic
990686338 5:58305661-58305683 GATCTATACATATCCATATTTGG - Intergenic
990802127 5:59616424-59616446 GATCTGACCACATCAATATTTGG - Intronic
990875640 5:60482054-60482076 GATCTCAGCATATGAATTTTGGG - Intronic
991668514 5:69023914-69023936 GATTTCAGCATATGAATATCAGG - Intergenic
993729052 5:91400938-91400960 GATTTCAGCATATCAATTTTTGG + Intergenic
994684733 5:102935204-102935226 TATCTCAGCATTTCTATATGTGG + Intronic
996694963 5:126384351-126384373 GATCTAAACACAGCAATATGAGG - Intronic
1003095945 6:3143765-3143787 GATCTAAGCATATCAATATGAGG + Intronic
1005423893 6:25680985-25681007 TCTCTAAGCATATCCATATAAGG - Intronic
1005913224 6:30328534-30328556 TATCTAACCCTTTCAATATGAGG + Intronic
1008359274 6:50595707-50595729 TATCTAAAAATATCTATATGAGG + Intergenic
1010496958 6:76545659-76545681 GATTTCAGCATATAAATCTGGGG - Intergenic
1013301787 6:108810784-108810806 GGTCTGAGTCTATCAATATGAGG + Intergenic
1017012895 6:150074990-150075012 GATTTAAGCAGATAAGTATGTGG + Intergenic
1020717505 7:11694559-11694581 GATCTCACCAAATCAATATAAGG + Intronic
1020946778 7:14619998-14620020 GATTTAAACTTATCAATATTAGG + Intronic
1021475017 7:21050922-21050944 GATCAAAGCATATAAATGTTTGG - Intergenic
1024668632 7:51569900-51569922 GATCTAAAAATAGAAATATGTGG - Intergenic
1026742099 7:72985145-72985167 GTTCTAAGCATATCCATATGTGG + Intergenic
1026801944 7:73405573-73405595 GTTCTAAGCATATCCACATGTGG + Intergenic
1027101636 7:75379932-75379954 GTTCTAAGCATATCCACATGTGG - Intergenic
1027289314 7:76686027-76686049 GATTTCAGCATATAAATTTGTGG + Intergenic
1028192960 7:87873815-87873837 GATCTAATTAAATGAATATGTGG - Intronic
1030467192 7:109917836-109917858 GATCTTAGCATATTAAAATGTGG + Intergenic
1030859164 7:114602729-114602751 GAGCTACGCATATCAATAATGGG + Intronic
1031475355 7:122214598-122214620 GATATAAATATATCTATATGTGG - Intergenic
1034702181 7:153105948-153105970 TCTCTAAGCATATCAATATCTGG + Intergenic
1035085704 7:156255638-156255660 GATTTAAGCATGTCAAGGTGAGG - Intergenic
1037459082 8:19091174-19091196 TATCTAAGCATATCTAAACGTGG - Intergenic
1039505615 8:38050258-38050280 GATCTAAGCAAATCAACAGGAGG - Intronic
1039650524 8:39336056-39336078 GATCTATGATTATCAATAAGTGG - Intergenic
1041908796 8:63065653-63065675 GATTTATGCATCTTAATATGTGG - Intronic
1042581315 8:70282182-70282204 TATTTGAGCATCTCAATATGGGG + Intronic
1042753104 8:72179848-72179870 GATCAAAGTATAGAAATATGTGG - Intergenic
1044505560 8:93013638-93013660 CAACTAAGAATATAAATATGTGG + Intronic
1045619977 8:103965184-103965206 CTTCTCAGCATATCAATTTGTGG - Intronic
1046773348 8:118138326-118138348 GATTTAAACATATGAATTTGGGG - Intergenic
1047874264 8:129117734-129117756 CAACTAAGCATTTCATTATGGGG + Intergenic
1050177173 9:2880343-2880365 GATATAAGAATATCAATAGAGGG + Intergenic
1051077580 9:13258719-13258741 GATCAAAGCCTATAAAAATGAGG - Intronic
1051358345 9:16260346-16260368 GATTTCAGCATATGAATTTGGGG - Intronic
1052008101 9:23374692-23374714 GATTTCAACATATGAATATGGGG + Intergenic
1056975944 9:91253788-91253810 TATCTAAATATATCACTATGTGG + Intronic
1189154571 X:38744077-38744099 GATTTCAGCATATGAATTTGGGG + Intergenic
1192988492 X:76426523-76426545 GATATAAACATATCAATAAAGGG + Intergenic
1195918219 X:109956705-109956727 GATTTAAACATATGAATTTGGGG - Intergenic
1197039051 X:121913027-121913049 TATCTATTAATATCAATATGTGG + Intergenic
1197977210 X:132178795-132178817 GATATAATCATATTAAAATGAGG - Intergenic
1199815624 X:151394567-151394589 GATTTCAGCATATGAATTTGGGG - Intergenic
1200345400 X:155442107-155442129 GATCCAAGCATATCAGTCAGAGG + Intergenic