ID: 1003096861

View in Genome Browser
Species Human (GRCh38)
Location 6:3149184-3149206
Sequence CTGGTTAGACAAAACTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003096859_1003096861 -2 Left 1003096859 6:3149163-3149185 CCTGTCAGTATGGACTCTGTGCT 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1003096861 6:3149184-3149206 CTGGTTAGACAAAACTGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003096861 Original CRISPR CTGGTTAGACAAAACTGTCC TGG Intronic
902202766 1:14845925-14845947 AAGGTTTGACAAAGCTGTCCAGG + Intronic
908153863 1:61332525-61332547 CTGATGTGACAAAACTGTCCTGG - Exonic
910571329 1:88707789-88707811 CTGGTTAGAAAAATATGACCAGG - Intronic
917263503 1:173195370-173195392 CTGATTAGGTAAAACTGTCCTGG + Intronic
918387639 1:184026195-184026217 TTGGCTAGAGGAAACTGTCCTGG + Intronic
920565108 1:206966948-206966970 CTGGTATGGTAAAACTGTCCAGG - Intronic
922063068 1:222110021-222110043 CTGGTTAGATACATCTGCCCTGG + Intergenic
1065583981 10:27199794-27199816 CTGGTTAGACGAGACTATCCTGG + Intronic
1071531124 10:86390975-86390997 CTGTTGAGCCAAAACTGTCTGGG + Intergenic
1074330156 10:112498936-112498958 CTGTTTAGATAAAACTCTACTGG - Intronic
1074419965 10:113299924-113299946 CTGGTTAGACAACAATGACCTGG - Intergenic
1075821293 10:125314725-125314747 CTGCTGAGAGGAAACTGTCCTGG + Intergenic
1076431925 10:130410129-130410151 CTGGTTGGACAAACCAGACCTGG + Intergenic
1077641732 11:3887557-3887579 CTGGTTAGAGAAACCTGTTAAGG + Intronic
1078542382 11:12222495-12222517 AGGGTTAGACAAACATGTCCAGG + Intronic
1079128378 11:17734419-17734441 CTGGTGAGACAAAGCTCTCCCGG - Intergenic
1084709245 11:70833891-70833913 CTGGGGAGACAACACTGTCCTGG - Intronic
1086982640 11:93215678-93215700 TTGGGAAGACAAAACAGTCCAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1099031698 12:77533807-77533829 CTGGTTAGACTAAATTTTGCAGG - Intergenic
1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG + Intergenic
1103338536 12:120208678-120208700 AAGGTTAAACAAAACTGCCCAGG + Intergenic
1104006865 12:124899069-124899091 CTGGGAAGACGAAACTGTTCTGG - Intergenic
1105314755 13:19247645-19247667 CTGGATAGACAAAACCCTCCTGG + Intergenic
1108158886 13:47617894-47617916 CTGATTTGACAAAATTGTCTTGG - Intergenic
1108668795 13:52660416-52660438 TTTGTTAGGCAGAACTGTCCTGG - Intronic
1109329894 13:60916531-60916553 CAGGGTAGACAAGATTGTCCAGG - Intergenic
1112197674 13:97241878-97241900 CTGGTTTGAGATAACTGTGCAGG + Intronic
1114850212 14:26374269-26374291 CCAGTTTGACAAGACTGTCCTGG - Intergenic
1118765826 14:68908693-68908715 CTGGTTGGACGACACTGCCCTGG - Intronic
1119570148 14:75662683-75662705 CTTGCTAGACAAACCTGGCCTGG - Intronic
1126693723 15:51308339-51308361 CTGGTCAGAGGAAAATGTCCTGG + Intronic
1130370056 15:83277602-83277624 CTACTTAGAAAAAACTGGCCAGG - Intronic
1137800703 16:51259677-51259699 CTGGTTAGAGAAGGCTGTACTGG + Intergenic
1146726073 17:35157165-35157187 ATGTTTATACAAAACTCTCCAGG + Intronic
1149896981 17:60435923-60435945 CTGCTTTGACAAAACTGTCAGGG - Intergenic
1152817936 17:82419247-82419269 CAGGTTGGAGAAAACTGTCTAGG - Intronic
1157960837 18:52151819-52151841 CTGCTTAGAAAATACAGTCCTGG + Intergenic
1165045448 19:33101263-33101285 CTGGGTAGCCCAATCTGTCCAGG + Intronic
1165644813 19:37426292-37426314 CTGCTCAGAGAAAACTGTACCGG - Exonic
1167678874 19:50906942-50906964 GTGGATAGAGAAAACCGTCCAGG - Exonic
925842727 2:8007535-8007557 CTGGCTAGACCAAGCTGTCATGG + Intergenic
930391494 2:50767005-50767027 CTGGCTAGACAAAAGATTCCTGG + Intronic
932381586 2:71288524-71288546 TTGGTTAAAAAAAAATGTCCTGG + Intronic
933512987 2:83264533-83264555 CTGGTCAGATAAAACTTTCAAGG - Intergenic
935362452 2:102258372-102258394 CTGGTTTAGCATAACTGTCCTGG + Intergenic
938243832 2:129762615-129762637 CTGGTGTGACAAGCCTGTCCTGG - Intergenic
940819999 2:158342501-158342523 TTGGTTAAACAAATCTGTTCTGG - Intronic
941464203 2:165806308-165806330 CTGTTAAGATAAAACTGGCCAGG - Intergenic
942693283 2:178610208-178610230 CTGGTGAGAACAAACTGTCATGG - Exonic
945478145 2:210310771-210310793 CTGGTTACACAGGACTGTGCAGG + Intronic
1175122943 20:56730336-56730358 CTGGGCAGACAAAACTGTTAAGG + Intergenic
954245080 3:49324917-49324939 CAAGCTAGACAACACTGTCCAGG - Exonic
954527040 3:51281125-51281147 GTGGTGAGCCAAGACTGTCCTGG + Intronic
957686230 3:83505999-83506021 CAGAATAGACAAAACTATCCTGG + Intergenic
959473952 3:106786738-106786760 CTTGTTAGACAAACCTTTTCTGG + Intergenic
963707686 3:148708676-148708698 TTAGATAGACAAAACAGTCCTGG - Intronic
967362417 3:188646913-188646935 CTAGCTAGACACAAATGTCCAGG - Intronic
972879191 4:43402706-43402728 CAGGTTAAACAAAAGTTTCCTGG - Intergenic
977995825 4:103496661-103496683 CTGGTTAGACACCCTTGTCCAGG - Intergenic
982131264 4:152230763-152230785 CGGGTGAAACAAGACTGTCCAGG - Intergenic
984764474 4:183389208-183389230 CAGGTTAGCCCAAACTCTCCAGG + Intergenic
986325550 5:6670615-6670637 ATGGGTAGAAAAAACAGTCCTGG + Intergenic
987238016 5:15963021-15963043 CTGGTTAGAAAAAACTCTAATGG + Intergenic
988795399 5:34648788-34648810 CTGGTTGGCCAAAAGTGACCTGG + Intergenic
989150630 5:38296028-38296050 CTGGTTACACCCAACTGTGCTGG + Intronic
990322893 5:54647381-54647403 CTCGTTAAAGAAAACTCTCCTGG - Intergenic
993044444 5:82851633-82851655 ATGCTTAGAAAAAACTGGCCTGG - Intergenic
1000433880 5:161184428-161184450 CCGGTGAGACAAATCTGGCCTGG + Intergenic
1002963604 6:1940989-1941011 CTGGGGGGACAAAACTGCCCTGG + Intronic
1003096861 6:3149184-3149206 CTGGTTAGACAAAACTGTCCTGG + Intronic
1003511664 6:6786178-6786200 CTGGATAGACTAAATGGTCCTGG + Intergenic
1004135741 6:12964551-12964573 CTCGTTCAACAAAACTGGCCTGG - Intronic
1004543885 6:16578190-16578212 CTGGTTAAACTAAAATGCCCAGG + Intronic
1004822033 6:19377781-19377803 CTGGTTACAGAAAACTATTCTGG - Intergenic
1006737882 6:36287636-36287658 CTGGTTAAACAAATCTATGCTGG - Intronic
1008603636 6:53119494-53119516 CTGGTCAGAAAAAACTGTTGTGG + Intergenic
1012636785 6:101552689-101552711 CAGGTTAGACACATCTGTCTGGG - Intronic
1017328482 6:153168547-153168569 TTGGTTAAACGAAACTGTCATGG - Intergenic
1018103638 6:160463445-160463467 CTAGTTACAGAAAGCTGTCCTGG - Intergenic
1019960209 7:4452690-4452712 CTAGTTAGAATAAATTGTCCAGG - Intergenic
1022414154 7:30163842-30163864 CAGGATTGGCAAAACTGTCCTGG + Intergenic
1022643791 7:32212398-32212420 CTGGATAGAGGAAACTCTCCTGG - Intronic
1033299336 7:140173200-140173222 CAGGTTAGACAGAACATTCCCGG + Intronic
1033325904 7:140378222-140378244 CTGTTTAGGCAAAACATTCCTGG - Intronic
1040102839 8:43520473-43520495 ATGGTAAGACAAAAGTGACCTGG - Intergenic
1042795858 8:72662570-72662592 CTGGTTGGACAACACTGTGGTGG + Intronic
1044657968 8:94568062-94568084 CTGGTTACAGAGCACTGTCCTGG - Intergenic
1051157777 9:14170115-14170137 CTCGCTGGACTAAACTGTCCAGG - Intronic
1051201629 9:14633286-14633308 CTGGTTAGTCAAAATTGGCTGGG + Intronic
1055246532 9:74251530-74251552 TTGGGTTGCCAAAACTGTCCAGG + Intergenic
1057995180 9:99816345-99816367 TTGGTTATACAAAAATGTCACGG + Intergenic
1193686585 X:84583931-84583953 CTTGTTACACATATCTGTCCGGG - Intergenic
1198024813 X:132694632-132694654 GTGGTTAGACAAGACTGTAGGGG + Intronic
1199305950 X:146267997-146268019 CTTGTTAGACACCACTTTCCTGG - Intergenic