ID: 1003098163

View in Genome Browser
Species Human (GRCh38)
Location 6:3157820-3157842
Sequence GAGCGGAGGACCCAGCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098163_1003098180 25 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098180 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
1003098163_1003098176 22 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098163_1003098182 26 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098182 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
1003098163_1003098177 23 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098177 6:3157866-3157888 CGCCCACTCTGGACCCCCGAGGG No data
1003098163_1003098183 30 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098183 6:3157873-3157895 TCTGGACCCCCGAGGGGGGCTGG No data
1003098163_1003098178 24 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098163_1003098171 12 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098171 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098163 Original CRISPR GAGCGGAGGACCCAGCGCCA GGG (reversed) Intergenic