ID: 1003098164

View in Genome Browser
Species Human (GRCh38)
Location 6:3157821-3157843
Sequence TGAGCGGAGGACCCAGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098164_1003098171 11 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098171 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
1003098164_1003098180 24 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098180 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
1003098164_1003098184 30 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098184 6:3157874-3157896 CTGGACCCCCGAGGGGGGCTGGG No data
1003098164_1003098183 29 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098183 6:3157873-3157895 TCTGGACCCCCGAGGGGGGCTGG No data
1003098164_1003098177 22 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098177 6:3157866-3157888 CGCCCACTCTGGACCCCCGAGGG No data
1003098164_1003098178 23 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098164_1003098182 25 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098182 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
1003098164_1003098176 21 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098164 Original CRISPR TGAGCGGAGGACCCAGCGCC AGG (reversed) Intergenic
No off target data available for this crispr