ID: 1003098165

View in Genome Browser
Species Human (GRCh38)
Location 6:3157834-3157856
Sequence GGGGATCGCGGCGTGAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098165_1003098190 24 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098190 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
1003098165_1003098182 12 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098182 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
1003098165_1003098176 8 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098165_1003098177 9 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098177 6:3157866-3157888 CGCCCACTCTGGACCCCCGAGGG No data
1003098165_1003098188 23 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data
1003098165_1003098185 18 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098185 6:3157875-3157897 TGGACCCCCGAGGGGGGCTGGGG No data
1003098165_1003098178 10 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098165_1003098192 25 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098192 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
1003098165_1003098180 11 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098180 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
1003098165_1003098184 17 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098184 6:3157874-3157896 CTGGACCCCCGAGGGGGGCTGGG No data
1003098165_1003098193 26 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098193 6:3157883-3157905 CGAGGGGGGCTGGGGACCGGGGG No data
1003098165_1003098171 -2 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098171 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
1003098165_1003098183 16 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098183 6:3157873-3157895 TCTGGACCCCCGAGGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098165 Original CRISPR GGGGATCGCGGCGTGAGCGG AGG (reversed) Intergenic