ID: 1003098166

View in Genome Browser
Species Human (GRCh38)
Location 6:3157837-3157859
Sequence GGTGGGGATCGCGGCGTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098166_1003098176 5 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098166_1003098193 23 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098193 6:3157883-3157905 CGAGGGGGGCTGGGGACCGGGGG No data
1003098166_1003098192 22 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098192 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
1003098166_1003098171 -5 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098171 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
1003098166_1003098182 9 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098182 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
1003098166_1003098184 14 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098184 6:3157874-3157896 CTGGACCCCCGAGGGGGGCTGGG No data
1003098166_1003098178 7 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098166_1003098183 13 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098183 6:3157873-3157895 TCTGGACCCCCGAGGGGGGCTGG No data
1003098166_1003098180 8 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098180 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
1003098166_1003098190 21 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098190 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
1003098166_1003098194 29 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098166_1003098185 15 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098185 6:3157875-3157897 TGGACCCCCGAGGGGGGCTGGGG No data
1003098166_1003098177 6 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098177 6:3157866-3157888 CGCCCACTCTGGACCCCCGAGGG No data
1003098166_1003098188 20 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098166 Original CRISPR GGTGGGGATCGCGGCGTGAG CGG (reversed) Intergenic